BBa_K341719 1 BBa_K341719 VL 2010-10-24T11:00:00Z 2015-05-08T01:12:08Z Crystal Structure of the Anti-His Tag Antibody 3D5 Single-chain Fragment Complexed to its Antigen Markus Kaufmann, Peter Lindner, Annemarie Honegger, Kerstin Blank Markus Tschopp, Guido Capitani, Andreas Plu?? ckthun* and Markus G. Gru?? tter* J. Mol. Biol. (2002) 318, 135???147 VL is the light chain of antibody. We also connect it after the ToxR gene. false false _468_ 0 7879 9 Not in stock false no false Wang Wanyang annotation2096063 1 VL range2096063 1 1 345 BBa_K341719_sequence 1 ggatccgacatcctgatgacccagaccccgctgtctctgccggtttctctgggtgaccaggcttctatctcttgccgttcttctcagtctatcgttcactctaacggtaacacctacctggaatggtacttgcagaaaccgggtcagtctccgaaactgctgatctacaaagtttctaaccgtttctctggtgttccggaccgtgtttctggttctggttctggtacctacttcaccctgaaaatctctcgtgttgaagctgaagacctgggtgtttactactgcttccagggttctcacgttccgttcaccttcggttctggtaccaaactggaaatcaaacgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z