BBa_J13002 1 BBa_J13002 TetR repressed POPS/RIPS generator 2005-06-15T11:00:00Z 2015-08-31T04:08:29Z Released HQ 2013 -- No description -- false true _37_5_ 0 88 37 In stock false true Jeff Tabor component1535786 1 BBa_B0034 component1535778 1 BBa_R0040 annotation1535778 1 BBa_R0040 range1535778 1 1 54 annotation1535786 1 BBa_B0034 range1535786 1 63 74 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K343000 1 BBa_K343000 Mutated flagella master regulator (FlhDC mut). 2010-07-01T11:00:00Z 2015-05-08T01:12:08Z E.Coli K12 Mg1655 The master regulator operon for flagellum synthesis. Produces transcriptional factors for Class II flagellar regulon genes. false false _465_ 0 6081 9 It's complicated true The sequence comes directly from E.Coli. false Lars Christian Lund annotation2072346 1 FlhC range2072346 1 359 929 annotation2072413 1 Changed a T to C to remove Pst1 restriction site. range2072413 1 822 822 annotation2072343 1 FlhD range2072343 1 1 349 annotation2072345 1 Start codon range2072345 1 356 358 annotation2072342 1 Start codon range2072342 1 1 3 annotation2072347 1 Stop codon range2072347 1 930 932 annotation2072344 1 Stop codon range2072344 1 350 352 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986787 1 -10 range1986787 1 43 48 annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 BBa_K343004 1 BBa_K343004 Flagella overekspression 2010-07-04T11:00:00Z 2015-05-08T01:12:08Z The promoter, the terminater and the RBS are all in the spring 2010 kit. The FlhDC mater operon is fron E. coli. This part entails a sigma 70 promoter, a RBS, the FlhDC master operon and a dual-terminator. This part will cause hyperflagellated cells. false false _465_ 0 6087 9 It's complicated true It has not been tested yet false Louise Linnebjerg Bohn Christoffersen, Pernille Marie Madsen, Sheila Maibom-Thomsen component2092207 1 BBa_K343000 component2092214 1 BBa_B0015 component2092199 1 BBa_J13002 annotation2092199 1 BBa_J13002 range2092199 1 1 74 annotation2092207 1 BBa_K343000 range2092207 1 81 1012 annotation2092214 1 BBa_B0015 range2092214 1 1021 1149 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J13002_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaa BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K343004_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgcatacctccgagttgctgaaacacatttatgacatcaacttgtcatatttactacttgcacagcgtttgattgttcaggacaaagcgtccgctatgtttcgtctcggcataaatgaagaaatggcgacaacgttagcggcactgactcttccgcaaatggttaagctggcagaaaccaatcaactggtttgtcacttccgttttgacagccaccagacgattactcagttgacgcaagattcccgcgttgacgatctccagcaaattcataccggcatcatgctctcaacacgcttgctgaatgatgttaatcagcctgaagaagcgctgcgcaagaaaagggcctgatcatgagtgaaaaaagcattgttcaggaagcgcgggatattcagctggcaatggaattgatcaccctgggcgctcgtttgcagatgctggaaagcgaaacacagttaagtcgcggacgcctgataaaactttataaagaactgcgcggaagcccaccgccgaaaggcatgctgccattctcaaccgactggtttatgacctgggaacaaaacgttcatgcttcgatgttctgtaatgcatggcagtttttactgaaaaccggtttgtgtaatggcgtcgatgcggtgatcaaagcctaccgtttataccttgaacagtgcccacaagcagaagaaggaccactgctggcattaacccgtgcctggacattggtgcggtttgttgaaagtggattactgcaactttccagctgcaactgctgcggcggcaattttattacccacgctcaccagcctgttggcagctttgcccgcagcttatgtcaaccgccatcccgggcagtaaaaagacgtaaactttcccagaatcctgccgatattatcccacaactgctggatgaacagagagtacaggctgtttaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K343000_sequence 1 atgcatacctccgagttgctgaaacacatttatgacatcaacttgtcatatttactacttgcacagcgtttgattgttcaggacaaagcgtccgctatgtttcgtctcggcataaatgaagaaatggcgacaacgttagcggcactgactcttccgcaaatggttaagctggcagaaaccaatcaactggtttgtcacttccgttttgacagccaccagacgattactcagttgacgcaagattcccgcgttgacgatctccagcaaattcataccggcatcatgctctcaacacgcttgctgaatgatgttaatcagcctgaagaagcgctgcgcaagaaaagggcctgatcatgagtgaaaaaagcattgttcaggaagcgcgggatattcagctggcaatggaattgatcaccctgggcgctcgtttgcagatgctggaaagcgaaacacagttaagtcgcggacgcctgataaaactttataaagaactgcgcggaagcccaccgccgaaaggcatgctgccattctcaaccgactggtttatgacctgggaacaaaacgttcatgcttcgatgttctgtaatgcatggcagtttttactgaaaaccggtttgtgtaatggcgtcgatgcggtgatcaaagcctaccgtttataccttgaacagtgcccacaagcagaagaaggaccactgctggcattaacccgtgcctggacattggtgcggtttgttgaaagtggattactgcaactttccagctgcaactgctgcggcggcaattttattacccacgctcaccagcctgttggcagctttgcccgcagcttatgtcaaccgccatcccgggcagtaaaaagacgtaaactttcccagaatcctgccgatattatcccacaactgctggatgaacagagagtacaggctgtttaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z