BBa_K343100 1 BBa_K343100 Flagella master regulating operon 2010-10-16T11:00:00Z 2015-05-08T01:12:08Z It is a natural part of the E.coli genome The flagella regulon in Escherichia coli is composed of at least 50 genes organized in no less than 14 ope-rons that all contribute to the synthesis and operation of flagella. The operons are synthesized in a three-level transcriptional cascade where the FlhDC operon is the master regulator at the top of the cascade. The flagella regulon is tightly controlled by nutritional and environmental conditions, E. coli starved of ami-no acids showed temporarily decrease of the flagella regulon transcripts which are needed for the synthesis and operation of the flagellum.[http://onlinelibrary.wiley.com/doi/10.1111/j.1365-2958.2009.06939.x/full (1)] The synthesis and assembly of flagella are regulated by the transcriptional cascade composed of three levels of gene products (class I, -II and ???III). Class I genes consist of a single operon encoding the proteins FlhD and FlhC that form a multimeric (FlhD4C2) transcriptional activation complex. This ???master regulator??? stimulates transcription by binding upstream of Class II promoters. Class II genes encode proteins that assemble to form the basal body and hook of the flagellum, as well as the fliA gene that encodes the alternative &#963; factor &#963;28, also called &#963;F. &#963;28 binds to RNA polymerase (RNAP) core enzyme and directs it to Class III promoters. Class III genes encode the rest of the structural genes of the flagellum, including fliC encoding flagellin, as well as the chemotaxis apparatus. [http://onlinelibrary.wiley.com/doi/10.1111/j.1365-2958.2009.06939.x/full (1)] <br> It has been shown that overexpression of the FlhDC operon restores motility in mutants that have been made immotile [http://jb.asm.org/cgi/content/short/181/24/7500 (2)]. Also, overexpression of FlhDC in the E. coli K12 strain MG1655 made the cells hypermotile.[http://iai.asm.org/cgi/content/abstract/75/7/3315 (3)] false false _465_ 0 6087 9 It's complicated true This part has an internal pst1 site in the FlhC part of the operon. We also designed a part where the internal pst1 site has been removed by introducing a silent mutation (part: BBa_343000) and a composite part BBa_K343004 false Louise Linnebjerg Bohn Christoffersen, Pernille Marie Madsen, Sheila Maibom-Thomsen annotation2104034 1 Stop Codon range2104034 1 930 932 annotation2103939 1 PstI restriction site range2103939 1 821 821 annotation2104031 1 Start codon range2104031 1 1 3 annotation2104032 1 Start Codon range2104032 1 356 358 annotation2104033 1 Stop Codon range2104033 1 350 352 annotation2104030 1 FlhD range2104030 1 1 349 annotation2088296 1 FlhC range2088296 1 359 929 BBa_K343100_sequence 1 atgcatacctccgagttgctgaaacacatttatgacatcaacttgtcatatttactacttgcacagcgtttgattgttcaggacaaagcgtccgctatgtttcgtctcggcataaatgaagaaatggcgacaacgttagcggcactgactcttccgcaaatggttaagctggcagaaaccaatcaactggtttgtcacttccgttttgacagccaccagacgattactcagttgacgcaagattcccgcgttgacgatctccagcaaattcataccggcatcatgctctcaacacgcttgctgaatgatgttaatcagcctgaagaagcgctgcgcaagaaaagggcctgatcatgagtgaaaaaagcattgttcaggaagcgcgggatattcagctggcaatggaattgatcaccctgggcgctcgtttgcagatgctggaaagcgaaacacagttaagtcgcggacgcctgataaaactttataaagaactgcgcggaagcccaccgccgaaaggcatgctgccattctcaaccgactggtttatgacctgggaacaaaacgttcatgcttcgatgttctgtaatgcatggcagtttttactgaaaaccggtttgtgtaatggcgtcgatgcggtgatcaaagcctaccgtttataccttgaacagtgcccacaagcagaagaaggaccactgctggcattaacccgtgcctggacattggtgcggtttgttgaaagtggattactgcaactttccagctgcaactgctgcggcggcaattttattacccacgctcaccagcctgttggcagctttgcctgcagcttatgtcaaccgccatcccgggcagtaaaaagacgtaaactttcccagaatcctgccgatattatcccacaactgctggatgaacagagagtacaggctgtttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z