BBa_K346001 1 BBa_K346001 RBS (B0034) + MerR (mercury-responsive transcription factor) 2010-10-07T11:00:00Z 2015-07-21T02:53:47Z The coding sequence of MerR comes from Tn, prefixed by an RBS part BBa_B0034 from Partsregistry This part was designed as a translational unit for MerR expression. false false _353_457_ 4206 4411 9 It's complicated true The native RBS of MerR is not strong enough and its intensity can not be predicted as there is no such a corresponding RBS part in Registry. In order to facilitate the use and further characterization of MerR for future team, we prefixed an RBS part BBa_B0034 from Partsregistry. false Ao Liu & Ying Sheng annotation2093291 1 B0034 range2093291 1 1 12 annotation2093295 1 merR range2093295 1 19 453 BBa_K346001_sequence 1 aaagaggagaaatactagatggaaaataatttggaaaacctgaccattggcgtttttgccaaggcggccggggtcaacgtggagacaatccgcttctatcagcgcaagggcctgttgcgggaaccggacaagccttacggcagcatccgccgctatggggaggcggacgtggttcgggtgaaattcgtgaaatcggcacagcggctggggttcagtctggacgagattgccgagctgttgcggctcgacgatggcacccactgcgaggaggccagcagcctggccgaacacaagctcaaggacgtgcgcgagaagatggccgacttggcgcgcatggaaaccgtgctgtctgaactcgtgtgcgcctgccatgcacgaaaggggaatgtttcctgcccgttgatcgcgtcactacagggcgaagcaggcctggcaaggtcagctatgccttag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z