BBa_K346026 1 BBa_K346026 PmerT promoter+phage activitor Ogr(BBa_746350) 2010-10-18T11:00:00Z 2015-05-08T01:12:09Z PmerT promoter+phage activitor Ogr(BBa_746350) PmerT promoter+phage activitor Ogr(BBa_746350) false false _457_ 0 5916 9 It's complicated false PmerT promoter+phage activitor Ogr(BBa_746350) false Mei Chen component2093368 1 BBa_K346002 component2093372 1 BBa_I746350 annotation2093372 1 BBa_I746350 range2093372 1 66 302 annotation2093368 1 BBa_K346002 range2093368 1 1 57 BBa_I746350 1 BBa_I746350 ogr activator from P2 phage 2007-09-10T11:00:00Z 2015-08-31T04:08:04Z plasmid DNA supplied by Prof. Richard Calendar, University of California. The ogr activator taken from P2 phage acts on a class of inducible promoters (parts I746360 to I746365), inducing their activity to varying degrees. The part sequence does already contain a ribosome binding site (B0034)! false false _116_ 0 2122 9 In stock true The part does contain a RBS (B0034) already. true Stefan Milde annotation1943865 1 B0034 range1943865 1 1 12 annotation1943866 1 P2 ogr range1943866 1 19 19 annotation1943867 1 P2 ogr range1943867 1 19 237 BBa_K346002 1 BBa_K346002 PmerT promoter (mercury-responsive) 2010-10-11T11:00:00Z 2015-07-14T12:33:51Z TTCCATATCGCTTGACTCCGTACATGAGTACGGAAGTAAGGTTACGCTATCCAATCC Released HQ 2013 This part was isolated from Tn21. When regulated by its cognate transcription factor MerR, it will represent a dose-response manner in response to the concentration of mercury. false false _457_ 4206 4411 9 In stock true It was divergently regulated by MerR false Qianzhu Wu & Mei Chen annotation2085551 1 promoter range2085551 1 1 57 BBa_K346002_sequence 1 ttccatatcgcttgactccgtacatgagtacggaagtaaggttacgctatccaatcc BBa_I746350_sequence 1 aaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaa BBa_K346026_sequence 1 ttccatatcgcttgactccgtacatgagtacggaagtaaggttacgctatccaatcctactagagaaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z