BBa_K346027 1 BBa_K346027 PmerT promoter+phage activitor Pag(BBa_I746351) 2010-10-18T11:00:00Z 2015-05-08T01:12:09Z PmerT promoter+phage activitor Pag(BBa_I746351) PmerT promoter+phage activitor Pag(BBa_I746351) false false _457_ 0 5916 9 It's complicated false PmerT promoter+phage activitor Pag(BBa_I746351) false Mei Chen component2093378 1 BBa_I746351 component2093374 1 BBa_K346002 annotation2093378 1 BBa_I746351 range2093378 1 66 302 annotation2093374 1 BBa_K346002 range2093374 1 1 57 BBa_K346002 1 BBa_K346002 PmerT promoter (mercury-responsive) 2010-10-11T11:00:00Z 2015-07-14T12:33:51Z TTCCATATCGCTTGACTCCGTACATGAGTACGGAAGTAAGGTTACGCTATCCAATCC Released HQ 2013 This part was isolated from Tn21. When regulated by its cognate transcription factor MerR, it will represent a dose-response manner in response to the concentration of mercury. false false _457_ 4206 4411 9 In stock true It was divergently regulated by MerR false Qianzhu Wu & Mei Chen annotation2085551 1 promoter range2085551 1 1 57 BBa_I746351 1 BBa_I746351 pag activator from PSP3 phage 2007-09-11T11:00:00Z 2015-08-31T04:08:04Z plasmid DNA supplied by Prof. Richard Calendar, University of California. The pag activator taken from PSP3 phage acts on a class of inducible promoters (parts I746360 to I746365), inducing their activity to varying degrees. The part sequence does already contain a ribosome binding site (B0034)! false false _116_ 0 2122 9 In stock true The part does contain a RBS (B0034) already. true Stefan Milde annotation1943869 1 PSP3 pag range1943869 1 19 19 annotation1943870 1 PSP3 pag range1943870 1 19 237 annotation1943868 1 B0034 range1943868 1 1 12 BBa_K346002_sequence 1 ttccatatcgcttgactccgtacatgagtacggaagtaaggttacgctatccaatcc BBa_I746351_sequence 1 aaagaggagaaatactagatgatgcactgcccgttatgccaaaacgctgcacatgctcgcactagccggtaccttagcaccgaaacgaaagaacgttatcaccagtgccaaaacataaattgcggatgtacatttatcacttttgagacactatcaagattcattgtgaaaccggggactgttgatcctgctccgccccaccccatcagaaaccaacaacagcaactttggctttga BBa_K346027_sequence 1 ttccatatcgcttgactccgtacatgagtacggaagtaaggttacgctatccaatcctactagagaaagaggagaaatactagatgatgcactgcccgttatgccaaaacgctgcacatgctcgcactagccggtaccttagcaccgaaacgaaagaacgttatcaccagtgccaaaacataaattgcggatgtacatttatcacttttgagacactatcaagattcattgtgaaaccggggactgttgatcctgctccgccccaccccatcagaaaccaacaacagcaactttggctttga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z