BBa_I746352 1 BBa_I746352 delta activator from phiR73 phage 2007-09-11T11:00:00Z 2015-08-31T04:08:04Z plasmid DNA supplied by Prof. Richard Calendar, University of California. The delta activator taken from phiR73 phage acts on a class of inducible promoters (parts I746360 to I746365), inducing their activity to varying degrees. The part sequence does already contain a ribosome binding site (B0034)! false false _116_ 0 2122 9 In stock true The part does contain a RBS (B0034) already. true Stefan Milde annotation1943873 1 phiR73 delta range1943873 1 22 22 annotation1943874 1 silent mutation to remove PstI site range1943874 1 102 102 annotation1943872 1 phiR73 delta range1943872 1 22 264 annotation1943871 1 B0034 range1943871 1 1 12 BBa_K346028 1 BBa_K346028 PmerT promoter+phage phiR73 activitor delta(BBa_I746352) 2010-10-18T11:00:00Z 2015-05-08T01:12:09Z PmerT promoter+phage phiR73 activitor delta(BBa_I746352) PmerT promoter+phage phiR73 activitor delta(BBa_I746352) false false _457_ 0 5916 9 It's complicated false PmerT promoter+phage phiR73 activitor delta(BBa_I746352) false Mei Chen component2093385 1 BBa_I746352 component2093380 1 BBa_K346002 annotation2093385 1 BBa_I746352 range2093385 1 66 329 annotation2093380 1 BBa_K346002 range2093380 1 1 57 BBa_K346002 1 BBa_K346002 PmerT promoter (mercury-responsive) 2010-10-11T11:00:00Z 2015-07-14T12:33:51Z TTCCATATCGCTTGACTCCGTACATGAGTACGGAAGTAAGGTTACGCTATCCAATCC Released HQ 2013 This part was isolated from Tn21. When regulated by its cognate transcription factor MerR, it will represent a dose-response manner in response to the concentration of mercury. false false _457_ 4206 4411 9 In stock true It was divergently regulated by MerR false Qianzhu Wu & Mei Chen annotation2085551 1 promoter range2085551 1 1 57 BBa_K346002_sequence 1 ttccatatcgcttgactccgtacatgagtacggaagtaaggttacgctatccaatcc BBa_K346028_sequence 1 ttccatatcgcttgactccgtacatgagtacggaagtaaggttacgctatccaatcctactagagaaagaggagaaatactagatgatgcgctgccctttctgtcgtcattcagcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatctccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggcaagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaa BBa_I746352_sequence 1 aaagaggagaaatactagatgatgcgctgccctttctgtcgtcattcagcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatctccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggcaagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z