BBa_K346052 1 BBa_K346052 T3 promoter(phi3.8) 2010-10-15T11:00:00Z 2015-05-08T01:12:09Z T3 phage This part is the T3 RNA polymerase driven promoter. false false _457_ 0 5871 9 It's complicated false we construct it by primer annealing false weiye wang BBa_K346052_sequence 1 aattaacactcactaaagggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z