BBa_K346059 1 BBa_K346059 PmerT promoter mutant 3 2010-10-17T11:00:00Z 2015-05-08T01:12:09Z 3 mutation of PmerT 3 mutation of PmerT false false _457_ 0 5916 9 It's complicated false 3 mutation of PmerT false Ao Liu annotation2093471 1 PmerT mutation 3 range2093471 1 1 57 BBa_K346059_sequence 1 ttccatatcgcttgacttcgtacatgagtacgttagtaaggttacgctatccaatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z