BBa_K346060 1 BBa_K346060 PmerT promoter mutant 88 2010-10-17T11:00:00Z 2015-05-08T01:12:09Z 88 mutation of PmerT 88 mutation of PmerT false false _457_ 0 5916 9 It's complicated false 88 mutation of PmerT false Ao Liu BBa_K346060_sequence 1 ttccatatcgcttgacgccgtacatgagtacggaagtaaggttacgctatccaatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z