BBa_J23109 1 BBa_J23109 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K346070 1 BBa_K346070 Constutitive promoter BBa_J23109+ogr activator(BBa_I746350) 2010-10-14T11:00:00Z 2015-05-08T01:12:10Z BBa_J23101 comes from the constitutive promoter library and ogr activator comes from P2 phage. This part was designed to measure the intereaction between the phage activator ogr and its cognate promoters. false false _457_ 0 6179 9 It's complicated false This part was designed to measure the intereaction between the phage activator ogr and its cognate promoters. false Tianze Zhu component2086240 1 BBa_I746350 component2086236 1 BBa_J23109 annotation2086240 1 BBa_I746350 range2086240 1 44 280 annotation2086236 1 BBa_J23109 range2086236 1 1 35 BBa_I746350 1 BBa_I746350 ogr activator from P2 phage 2007-09-10T11:00:00Z 2015-08-31T04:08:04Z plasmid DNA supplied by Prof. Richard Calendar, University of California. The ogr activator taken from P2 phage acts on a class of inducible promoters (parts I746360 to I746365), inducing their activity to varying degrees. The part sequence does already contain a ribosome binding site (B0034)! false false _116_ 0 2122 9 In stock true The part does contain a RBS (B0034) already. true Stefan Milde annotation1943867 1 P2 ogr range1943867 1 19 237 annotation1943865 1 B0034 range1943865 1 1 12 annotation1943866 1 P2 ogr range1943866 1 19 19 BBa_J23109_sequence 1 tttacagctagctcagtcctagggactgtgctagc BBa_I746350_sequence 1 aaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaa BBa_K346070_sequence 1 tttacagctagctcagtcctagggactgtgctagctactagagaaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z