BBa_I746350 1 BBa_I746350 ogr activator from P2 phage 2007-09-10T11:00:00Z 2015-08-31T04:08:04Z plasmid DNA supplied by Prof. Richard Calendar, University of California. The ogr activator taken from P2 phage acts on a class of inducible promoters (parts I746360 to I746365), inducing their activity to varying degrees. The part sequence does already contain a ribosome binding site (B0034)! false false _116_ 0 2122 9 In stock true The part does contain a RBS (B0034) already. true Stefan Milde annotation1943866 1 P2 ogr range1943866 1 19 19 annotation1943865 1 B0034 range1943865 1 1 12 annotation1943867 1 P2 ogr range1943867 1 19 237 BBa_K346072 1 BBa_K346072 Constutitive promoter BBa_J23114+ogr activator(BBa_I746350) 2010-10-17T11:00:00Z 2015-05-08T01:12:10Z Constutitive promoter BBa_J23114+ogr activator(BBa_I746352) Constutitive promoter BBa_J23114+ogr activator(BBa_I746352) false false _457_ 0 5916 9 It's complicated false Constutitive promoter BBa_J23114+ogr activator(BBa_I746352) false Tianze Zhu component2090281 1 BBa_J23114 component2090285 1 BBa_I746350 annotation2090281 1 BBa_J23114 range2090281 1 1 35 annotation2090285 1 BBa_I746350 range2090285 1 44 280 BBa_J23114 1 BBa_J23114 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23114_sequence 1 tttatggctagctcagtcctaggtacaatgctagc BBa_I746350_sequence 1 aaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaa BBa_K346072_sequence 1 tttatggctagctcagtcctaggtacaatgctagctactagagaaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z