BBa_I746352 1 BBa_I746352 delta activator from phiR73 phage 2007-09-11T11:00:00Z 2015-08-31T04:08:04Z plasmid DNA supplied by Prof. Richard Calendar, University of California. The delta activator taken from phiR73 phage acts on a class of inducible promoters (parts I746360 to I746365), inducing their activity to varying degrees. The part sequence does already contain a ribosome binding site (B0034)! false false _116_ 0 2122 9 In stock true The part does contain a RBS (B0034) already. true Stefan Milde annotation1943873 1 phiR73 delta range1943873 1 22 22 annotation1943874 1 silent mutation to remove PstI site range1943874 1 102 102 annotation1943871 1 B0034 range1943871 1 1 12 annotation1943872 1 phiR73 delta range1943872 1 22 264 BBa_K346081 1 BBa_K346081 Constutitive promoter BBa_J23116+pag activator(BBa_I746352) 2010-10-17T11:00:00Z 2015-05-08T01:12:10Z Constutitive promoter BBa_J23116+pag activator(BBa_I746352) Constutitive promoter BBa_J23116+pag activator(BBa_I746352) true false _457_ 0 5916 9 Discontinued false Constutitive promoter BBa_J23116+pag activator(BBa_I746352) false Ying Sheng component2090344 1 BBa_J23116 component2090349 1 BBa_I746352 annotation2090344 1 BBa_J23116 range2090344 1 1 35 annotation2090349 1 BBa_I746352 range2090349 1 44 307 BBa_J23116 1 BBa_J23116 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23116_sequence 1 ttgacagctagctcagtcctagggactatgctagc BBa_K346081_sequence 1 ttgacagctagctcagtcctagggactatgctagctactagagaaagaggagaaatactagatgatgcgctgccctttctgtcgtcattcagcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatctccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggcaagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaa BBa_I746352_sequence 1 aaagaggagaaatactagatgatgcgctgccctttctgtcgtcattcagcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatctccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggcaagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z