BBa_K351008 1 BBa_K351008 Singlechain antibody for TB MPT51 protein 2010-10-24T11:00:00Z 2015-05-08T01:12:11Z It is consist of heavy and light chain of known antibody of MPT51, 16A1. This sequence is the single chain antibody sequence of MPT51.This sequence itself also antibody. But It can be the antigen binding domain of our fusion receptor false false _462_ 0 6043 9 It's complicated false This is synthetic antibody. And the antigen-determine domain of antibody receptor. So if you want to change the target antibody, this sequence should be changed. false Dongchan Yang BBa_K351008_sequence 1 cgccccgtcccgccatggcggccgcgggattcgattacccagtctccagcaatcatgtctgcatctctaggggagaaggtcaccatgacctgcagggccagctcaagtgtaaattacatgtactggtaccagcagaagtcagacgcctcccccaaactttggatttattacacatccaacctggctcctggagtcccagttcgcttcagtggcagtgggtctgggaactcttattctctcacaatcagcagcatggagggtgaagatgctgccacttattactgccagcagtttactagttccccgtacacgttcggaggggggaccaagctggaaataaaacgggctgatgctgcaccaggtggtggtggttctggtggtggtggttctgaggagtctggggga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z