BBa_K352002 1 BBa_K352002 pCooF Promoter from Rhodospirillum rubrum 2010-10-01T11:00:00Z 2015-05-08T01:12:11Z S.W. Singer, M.B. Hirst and P.W. Ludden, CO-dependent H2 evolution by Rhodospirillum rubrum: role of CODH:CooF complex, Biochim Biophys Acta - Bioenerg 1757 (2006), pp. 1582???1591 CooA is a CO-sensing protein that activates the transcription of genes encoding the CO-oxidation (coo) regulon, whose polypeptide products are required for utilizing CO as an energy source in Rhodospirillum rubrum. CooA binds to a position overlapping the -35 element of the P(cooF) promoter, similar to the arrangement of class II CRP (cAMP receptor protein)- and FNR (fumarate and nitrate reductase activator protein)-dependent promoters when expressed in Escherichia coli. The CO-dependent anaerobic growth of Rhodospirillum rubrum relies on a CO oxidation system encoded by two CO regulated transcriptional units, cooMKLXUH and cooFSCTJ. The key products of the coo regulon are an O2- sensitive CO dehydrogenase (CooS), a CooS-associated Fe-S protein (CooF), and a CO-tolerant hydrogenase (CooH), and the expression of the genes depends upon the activity of the CooA protein, which senses CO under anaerobic conditions. CO-independent basal level transcription of PcooF is not detectable due to the absence of active CooA. false false _474_ 0 5815 9 It's complicated false The sequence information was acquired from NCBI and physical DNA was synthesized from GENEART. Classical cloning strategies(restriction digestion) were used to produce biobricks. false Ozkan IS annotation2081254 1 CooA binding site range2081254 1 52 56 annotation2081252 1 A+T rich sequence range2081252 1 8 33 annotation2081256 1 Transcription Start range2081256 1 92 93 annotation2081257 1 Protected by CooA range2081257 1 36 61 annotation2081255 1 -10 Region range2081255 1 79 84 annotation2081253 1 CooA binding site range2081253 1 41 44 annotation2081258 1 Protected by CooA+RNAP range2081258 1 23 91 BBa_K352002_sequence 1 ttcggcgtcttttcatacccccataaaaactctggataactgtcatctggccgacagacggggccgggctttttgtcgcttactcggcgccagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z