BBa_K352005 1 BBa_K352005 C4G Mutated pCooF From Rhodospirillum rubrum 2010-10-01T11:00:00Z 2015-05-08T01:12:11Z De Vooght KM, van Wijk R, van Solinge WW. Management of gene promoter mutations in molecular diagnostics. Clin. Chem.55(4),698???708 (2009). This part is the mutated version of pCooF promoter. The mutation involves conversion cytosine to guanine at fourth base. The binding strength of pCooF to CooA is expected to diminish. CooA is a CO-sensing protein that activates the transcription of genes encoding the CO-oxidation (coo) regulon, whose polypeptide products are required for utilizing CO as an energy source in Rhodospirillum rubrum. CooA binds to a position overlapping the 35 element of the P(cooF) promoter, similar to the arrangement of class II CRP (cAMP receptor protein)and FNR (fumarate and nitrate reductase activator protein)-dependent promoters when expressed in Escherichia coli. The CO-dependent anaerobic growth of Rhodospirillum rubrum relies on a CO oxidation system encoded by two CO regulated transcriptional units, cooMKLXUH and cooFSCTJ. The key products of the coo regulon are an O2- sensitive CO dehydrogenase (CooS), a CooS-associated Fe-S protein (CooF), and a CO-tolerant hydrogenase (CooH), and the expression of the genes depends upon the activity of the CooA protein, which senses CO under anaerobic conditions. CO-independent basal level transcription of PcooF is not detectable due to the absence of active CooA. false false _474_ 0 6078 9 It's complicated false The sequence information was acquired from NCBI and physical DNA was synthesized from GENEART. Classical cloning strategies(restriction digestion) were used to produce biobricks. false Selin Akkuzu annotation2081270 1 Transcription Start Side range2081270 1 92 93 annotation2081273 1 Protected by CooA+RNAP range2081273 1 23 91 annotation2081271 1 -10 Region range2081271 1 79 86 annotation2081272 1 A+T Rich Sequence range2081272 1 8 33 annotation2081265 1 CooA Binding Side range2081265 1 52 58 annotation2081274 1 Protected by CooA range2081274 1 36 61 annotation2081262 1 CooA Binding Side range2081262 1 41 44 BBa_K352005_sequence 1 ttcggcgtcttttcatacccccataaaaactctggataactgtgatctggccgacagacggggccgggctttttgtcgcttactcggcgccagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z