BBa_K352013 1 BBa_K352013 CooA coupled with pTetR+RBS+Double Terminator 2010-10-15T11:00:00Z 2015-05-08T01:12:11Z - CooA coupled with pTetR,RBS,double terminator false false _474_ 0 6078 9 Not in stock false Device created from a composite of parts. false Sibel Ataol component2087395 1 BBa_K352001 component2087403 1 BBa_B0010 component2087396 1 BBa_R0040 component2087402 1 BBa_B0034 component2087405 1 BBa_B0012 annotation2087395 1 BBa_K352001 range2087395 1 1 669 annotation2087396 1 BBa_R0040 range2087396 1 678 731 annotation2087405 1 BBa_B0012 range2087405 1 848 888 annotation2087402 1 BBa_B0034 range2087402 1 740 751 annotation2087403 1 BBa_B0010 range2087403 1 760 839 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K352001 1 BBa_K352001 CooA from Rhodospirillum rubrum 2010-10-01T11:00:00Z 2015-05-08T01:12:11Z Hwan Youn, Robert L. Kerby, Mary Conrad, et al. 2004. Functionally Critical Elements of CooA-Related CO Sensors. J. Bacteriol. 186(5):1320-1329. doi:10.1128/JB.186.5.1320-1329.2004. CooA is a heme-containing transcriptional activator that enables Rhodospirillum rubrum to sense and grow on CO as a sole energy source. CooA is a member of a family of transcriptional regulators similar to the cAMP receptor protein and fumavate nitrate reduction from Escherichia coli. The protein is active in sequence-specific DNA binding in the presence of CO, but not in the absence of CO. The protein to be a dimer in the absence of CO. The product, CooA, is 28% identical (51% similar) to CRP(cAMP receptor protein) and 18% identical (45% similar) to FNR(fumavate nitrate reduction) from Escherichia coli. Inactive Fe(II) CooA structure adapted from that of the strain with PDB identification no. 1FT9. The protein consists of two monomers, shaded differently, which dimerize along the central C-helices of adjacent effector-binding domains. The solved structure is asymmetric, in which one monomer contains fused C- and D-helices. Nonetheless, both F-helices that interact with DNA in a sequence-specific manner are buried from the surface in the structure. The 4/5 loop is noted and so are the Pro2 and His77 heme Fe(II) ligands. false false _474_606_ 0 5815 9 It's complicated true The sequence information was acquired from NCBI and physical DNA was synthesized from GENEART. Classical cloning strategies(restriction digestion) were used to produce biobricks. false Cihan Tastan annotation2081251 1 Start Codon range2081251 1 1 3 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K352013_sequence 1 atgccaccacgcttcaatattgcaaacgtactgctgtctcctgatggtgagacgttcttccgcggttttcgctctaagattcatgcgaaaggctctctggtatgtactggtgaaggtgatgaaaacggtgtttttgttgtggttgatggtcgcctgcgtgtttacctggttggtgaggagcgtgagattagcctgttctacctgacttccggcgatatgttctgcatgcattccggctgcctggttgaagccaccgagcgcaccgaagtgcgtttcgccgatatccgcacgttcgagcagaaactgcaaacctgtccgtctatggcatggggcctgatcgccattctgggccgtgctctgacctcctgtatgcgtaccatcgaagacctgatgttccacgatattaaacaacgtatcgcgggctttttcatcgaccacgctaacactaccggtcgccagactcagggtggcgtaattgtttctgttgacttcactgtagaggaaatcgctaatctgatcggtagctcccgccagactactagcacggcgctgaactctctgattaaagagggttacatctcccgccagggccgtggtcactatactatcccgaacctggttcgcctgaaggcggctgcggatggtgaccgcgatgacgatgacgattgatactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K352001_sequence 1 atgccaccacgcttcaatattgcaaacgtactgctgtctcctgatggtgagacgttcttccgcggttttcgctctaagattcatgcgaaaggctctctggtatgtactggtgaaggtgatgaaaacggtgtttttgttgtggttgatggtcgcctgcgtgtttacctggttggtgaggagcgtgagattagcctgttctacctgacttccggcgatatgttctgcatgcattccggctgcctggttgaagccaccgagcgcaccgaagtgcgtttcgccgatatccgcacgttcgagcagaaactgcaaacctgtccgtctatggcatggggcctgatcgccattctgggccgtgctctgacctcctgtatgcgtaccatcgaagacctgatgttccacgatattaaacaacgtatcgcgggctttttcatcgaccacgctaacactaccggtcgccagactcagggtggcgtaattgtttctgttgacttcactgtagaggaaatcgctaatctgatcggtagctcccgccagactactagcacggcgctgaactctctgattaaagagggttacatctcccgccagggccgtggtcactatactatcccgaacctggttcgcctgaaggcggctgcggatggtgaccgcgatgacgatgacgattga BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z