BBa_K354000 1 BBa_K354000 Lac/Ara-1 IPTG Inducible Promoter 2010-10-18T11:00:00Z 2015-05-08T01:12:11Z The promoter was synthesised via primer extension. Derived from the L-arabinose and Lactose operons, this synthetic promoter remains in the 'off' state due to the repression of the AraC protein. AraC is constitutively expressed in bacteria possessing the arabinose operon and as such is present in E. coli. When exogenous arabinose and/or IPTG is added, the AraC protein is freed from the promoter thus allowing RNA polymerase to bind and initiate transcription. Hence, addition of arabinose or IPTG will switch the promoter into the 'on' state. false false _481_ 0 6469 9 It's complicated false The affiliation between AraC and its binding sequence had to be ensured so as to prevent basal expression and false triggering of the promoter. false Gregory Meyer annotation2090005 1 Lac Operon operator Sequence range2090005 1 72 102 annotation2090003 1 Symmetrical Synthetic Operator range2090003 1 44 57 annotation2090001 1 -33 Hexamer range2090001 1 38 43 annotation2090002 1 AraC Binding Site range2090002 1 2 37 annotation2090004 1 -10 Hexamer range2090004 1 58 66 BBa_K354000_sequence 1 gcatagcatttttatccataagattagcggatctaacctttacaattgtgagcgctcacaattatgatagattcaattgtgagcggataacaatttcacacagat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z