BBa_K354003 1 BBa_K354003 PlcR Promoter 2010-10-19T11:00:00Z 2015-05-08T01:12:11Z The sequence is derived from the PlcR promoter in Bacillus thuringiensis and was synthesized via primer extension. The PlcR promoter is positively regulated by the PlcR-PapR fusion peptide and is repressed by the SpooA peptide. Derived from Bacillus thuringiensis, the PlcR promoter regulates the expression of a host of genes, one of which is the PlcR gene itself. Thus there exists a positive-feedback loop controlling the activation of the operon. Within the promoter are clearly defined binding regions for both the PlcR-PapR fusion peptide as well as the SpooA repressor protein. false false _481_ 0 6469 9 It's complicated false So as to create a library of promoters with differing transcriptional activities, randomised nucleotides were introduced into the -10 box - the binding site for the RNAP sigma-factor. false Gregory Meyer annotation2090418 1 PlcR binding site range2090418 1 27 43 annotation2093187 1 SpoOA binding site range2093187 1 9 15 annotation2090419 1 Transcriptional start site range2090419 1 75 75 annotation2090417 1 Sigma A binding site range2090417 1 64 69 annotation2093188 1 SpoOA binding site range2093188 1 51 57 BBa_K354003_sequence 1 gaaaaatttgccgaattttatatatatatgcattatttcatatcaaaaattgtcgaatccacattattgtagtggtatgacaactt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z