BBa_K357002 1 BBa_K357002 muconolactone Delta-isomerase or muconolactone D-isomerase 2010-06-22T11:00:00Z 2015-05-08T01:12:11Z AUTHORS Nelson,K., Paulsen,I., Weinel,C., Dodson,R., Hilbert,H., Fouts,D., Gill,S., Pop,M., Martins Dos Santos,V., Holmes,M., Brinkac,L., Beanan,M., DeBoy,R., Daugherty,S., Kolonay,J., Madupu,R., Nelson,W., White,O., Peterson,J., Khouri,H., Hance,I., Lee,P., Holtzapple,E., Scanlan,D., Tran,K., Moazzez,A., Utterback,T., Rizzo,M., Lee,K., Kosack,D., Moestl,D., Wedler,H., Lauber,J., Hoheisel,J., Straetz,M., Heim,S., Kiewitz,C., Eisen,J., Timmis,K., Duesterhoft,A., Tummler,B. and Fraser,C. TITLE Complete genome sequence and comparative analysis of the metabolically versatile Pseudomonas putida KT2440 JOURNAL Environ. Microbiol. 4 (12), 799-808 (2002) The muconolactone Delta-isomerase (EC 5.3.3.4) is an enzyme that catalyzes the chemical reaction which converts (S)-5-oxo-2,5-dihydrofuran-2-acetate to 5-oxo-4,5-dihydrofuran-2-acetate. This enzyme belongs to the family of isomerases, specifically those intramolecular oxidoreductases transposing C=C bonds. The systematic name of this enzyme class is 5-oxo-4,5-dihydrofuran-2-acetate Delta3-Delta2-isomerase. This enzyme is also called muconolactone isomerase. This enzyme participates in benzoate degradation via hydroxylation. false false _530_ 0 5655 9 Not in stock true The sequence was changed from the original to remove a PstI restriction site located around bp 104, to remove the restriction site while maintaining a conserved aa sequence. false Anish Kapadia annotation2072349 1 Stop Codon range2072349 1 289 291 annotation2072348 1 Start Codon range2072348 1 1 3 BBa_K357002_sequence 1 atgttgttccacgtgaagatgaccgtgaagctgccggtcgacatggacccggccaaggccgcccagctcaaggccgacgaaaaggaactggcccagcgcctccagcgcgaaggcatctggcgtcacctgtggcgcattgccgggcattacgccaactacagcgtgttcgatgtgcccagcgtcgaggcattgcatgacacgctgatgcagctgccgctgttcccgtacatggatatcgaggtcgacggcctgtgtcggcatccctcgtctattcacagcgacgatcgctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z