BBa_K360010 1 BBa_K360010 luxY codes YFP, a light wavelength shifting protein 2010-10-20T11:00:00Z 2015-05-08T01:12:12Z Biochemistry 1990, 29, 5509-55 15 5509<br\> Cloning and Expression of the luxY Gene from Vibrio fischeri Strain Y-1 in Escherichia coli and Complete Amino Acid Sequence of the Yellow Fluorescent Protein<br\> Thomas 0. Baldwin, Mary L. Treat, and S. Colette Daubner<br\> Department of Biochemistry and Biophysics, Texas A&M University, and Texas Agricultural Experiment Station, College Station, Texas 77843<br\> Received December 5, 1989; Revised Manuscript Received February 13, 1990<br\> Page. 5512 Vibrio fischeri is a symbiotic marine bacterium which shows luminescence under certain conditions.<br\> The light emission reaction is catalyzed by a bacterial luciferase coded in the luxA and luxB genes, both placed within lux operon, this operon also contains genes for the synthesis of the substrates required in this reaction (luxC, luxD, luxE).<br\> This is the reaction catalyzed by Vibrio fischeri luciferase (luxAB genes).<br\> <br\> FMNH2 + 02 + RCHO -> hv + FMN + H20 + RCOOH(1)<br\> <br\> luxY gene codes YFP, a protein that changes the normal light emission wavelength of Vibrio fischeri from 484nm (blue) to 534nm (yellow).<br\> luxY gene was isolated from Vibrio fischeri strain Y-1 (2).<br\> The yellow emission has been postulated previously to result from energy transfer from an electronically excited species formed in the bacterial luciferase-catalyzed reaction to a secondary emitter protein (1) called YFP.<br\> <br\> YFP works together with V. fischeri luxAB products so it must be placed into the same strain (eg. It can either be cotransformated with a plasmid carrying Vibrio fischeri luxAB system or ligated into the same plasmid) (1).<br\> Because YFP is a Vibrio fischeri protein, it only works with Vibrio fischeri luciferases although it might work with luciferases from other bacteria species.<br\> It should be kept in mind that YFP only changes the light emission wavelength of luciferases, it does not produce light by itself.<br\> <br\> Something else to consider is that YFP only works below 18??C, higher temperatures may interfere with the native conformation of the protein(1) disrupting the light shifting function and the only phenotype observed would be that produced by luxAB light emission.<br\> false false _485_ 0 7481 9 Not in stock false The sequence was synthesized. false Nelson Augusto Berrocal Quezada BBa_K360010_sequence 1 atgtttaaaggtatagtagaaggtataggaatcattgaaaaaattgatatatatactgacctagataagtatgcaattcgatttcctgaaaatatgttgaatggaattaaaaaggagtcgtcaataatgtttaacggatgcttcttaacggtaactagcgtaaattcaaacattgtctggtttgatatatttgaaaaagaagcacgtaagcttgatacttttcgggaatataaggtaggtgaccgagtaaatttaggaacattcccaaaatttggcgctgcatctggtgggcatatattatcagcaaggatttcatgtgtagcaagtattattgaaataatagaaaatgaggattatcaacaaatgtggattcaaattcctgaaaattttacagagtttcttattgataaagactatattgctgtggatggtattagcttaactattgacactataaaaaacaaccaatttttcattagtttacccttaaaaatagcacaaaatacaaatatgaaatggcgaaaaaaaggtgataaggtaaatgttgagttatcaaacaaaattaatgctaaccagtgttggtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z