BBa_K360041 1 BBa_K360041 Minimum Blue Light Receptor Promoter 2010-09-11T11:00:00Z 2015-05-08T01:12:12Z Synthetized as a primer to insert this minimum blue promoter into a plasmid This is a short version of the promoter (BBa_K238013) activated by the blue light receptor system YcgF/YcgE, the original promoter was described and characterized by the K.U. Leuven 2009 team. This short promoter includes nucleotides from 26-75 of the original sequence reported by the K.U. Leuven 2009 team. false false _485_ 0 7013 9 It's complicated true When designing this short version of the blue promoter we considered to include the following elements: -35 box, spacer, -10 box, TSS and inverted repeat 1 and 2 false Jorge Eduardo Buend??a Buend??a annotation2079888 1 inverted repeat part 1 range2079888 1 28 34 annotation2079885 1 -35 box range2079885 1 3 8 annotation2079886 1 spacer range2079886 1 9 26 annotation2079890 1 transcription start site range2079890 1 38 40 annotation2079887 1 -10 box range2079887 1 27 33 annotation2079889 1 inverted repeat part 2 range2079889 1 42 48 BBa_K360041_sequence 1 tgtacacatatttcgtacaagtttgctattgttacttcacttaacattga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z