BBa_K360114 1 BBa_K360114 Primer to change RBS of P. pyralis luciferase 2010-10-14T11:00:00Z 2015-05-08T01:12:12Z This primer is composed by the prefix, the RBS BBa_B0034, and a spacer of 7 nucleotides. As reported in the design notes of part BBa_K216015, its sequencing shows an unexpected insertion of 6 bases, ACCACC, after the scar between the RBS and the ATG of the luciferase coding sequence; that is, the sequence reads ACTAGACCACCATG rather than ACTAGATG. This makes the RBS 12 bases from the ATG, somewhat more than the optimum. This primer intends to reestablish the efficiency. false false _485_ 0 6649 9 Not in stock false We were not able to carry out an appropriate assay to check whether deleting the insertion was more efficient. false Mariana Ruiz Velasco Leyva BBa_K360114_sequence 1 gctctagagaggaaacagctatggaagacgccaaaaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z