BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation1014044 1 mrfp1 range1014044 1 1 675 annotation2214014 1 Help:Barcodes range2214014 1 682 706 BBa_K093005 1 RBS-RFP RFP with RBS 2008-10-27T12:00:00Z 2015-05-08T01:08:40Z registry plasmids Released HQ 2013 RFP, BBa_E1010, with Elowitz RBS, BBa_B0034. false false _247_ 0 3630 9 In stock false The part was needed for downstream applications. There can be no expression of a reporter without a ribosome binding site. true Kathy Lam, Danielle Nash component2244025 1 BBa_E1010 component2244022 1 BBa_B0034 annotation2244022 1 BBa_B0034 range2244022 1 1 12 annotation2244025 1 BBa_E1010 range2244025 1 19 724 BBa_K360123 1 BBa_K360123 trpL promoter + RFP protein 2010-10-20T11:00:00Z 2015-05-08T01:12:12Z LovTAP was assembled in the following article: Strickland, D., Moffat, K., and Sosnick, T. (2008). Light-activated DNA binding in a designed allosteric protein. Proceedings of the National Academy of Sciences, 105(31), 10709. National Acad Sciences. Retrieved from http://www.pnas.org/content/105/31/10709.full. This photoreceptor was assembled by Strickland et al, and consists of a LOV (light-oxygen-voltage) domain of Avena sativa phototropin1 (AsLOV2)that senses blue light, fused to the trpR- DNA binding domain of the transcription factor trp repressor. The resulting protein is called LovTAP: LOV- and tryptophan-activated protein. LOV domains bind a flavin-mononucleotide (FMN) or flavin-adenine-dinucleotide (FAD) cofactor, which are used in a wide variety of metabolic pathways as cofactors in redox reactions and are available in most organisms. The cofactor has a broad absorption spectrum, with a maximum at 450 nm. Besides, the core of the LOV domain is often flanked by amino- or carboxy-terminal helices, termed Aa and Ja, respectively. In the LovTAP construction, AsLOV2 domain via its carboxyl-terminal Ja ???helix was ligated to an amino-terminal truncation of TrpR. The resulting protein has a domain-domain overlap with a shared helix. Thus, photoexcitation would change the conformation of the protein, in turn changing the stability of the shared-helix-domain contacts. false true _485_ 0 6618 9 It's complicated false We decided to synthesize a new LovTap part, that in comparison with the Part:BBa_K191006 [1] that is already at the registry, has the following differences: 1.The 2 PstI restriction sites were removed from the coding region of LovTap. 2.We included a punctual mutation to change the ILE427 by a PHE427, as was proposed by the model results of the team iGEM09_EPF-Lausanne [2]. With this mutation LovTAP should react faster and the conformational change should be more stable (the protein stays in the active form for longer, under light induction). The reason of the conformational change is the following: Cys450 side chain is involved in light state in bond formation with the cofactor. Cys450 can assume two conformational states, called here ON and OFF, and corresponding respectively, to the Sg being near or far from FMN[2]. The isoleucine 427 is quite big. But not enough to push the cystein's side chain significantly toward the cofactor. So we choose to replace this ILE427 by an PHE427, an amino acid which is much bigger and have more or less the same propreties than the ILE[2]. 3. The stop codon tga was changed for two taa. false Claudia Ivonne Hernandez Armenta, Jorge Zepeda component2247575 1 BBa_K093005 component2247569 1 BBa_K360023 annotation2247575 1 BBa_K093005 range2247575 1 58 781 annotation2247569 1 BBa_K360023 range2247569 1 1 49 BBa_K360023 1 BBa_K360023 trpL promoter 2010-10-20T11:00:00Z 2015-05-08T01:12:12Z LovTAP was assembled by Strickland et al. Reference Strickland, D., Moffat, K., & Sosnick, T. (2008). Light-activated DNA binding in a designed allosteric protein. Proceedings of the National Academy of Sciences, 105(31), 10709. National Acad Sciences. Retrieved from http://www.pnas.org/content/105/31/10709.full. Released HQ 2013 LovTAP This photoreceptor was assembled by Strickland et al., and consists of a LOV (light-oxygen-voltage) domain of Avena sativa phototropin1 (AsLOV2) that senses blue light, fused to the trpR- DNA binding domain of the transcription factor trp repressor. The resulting protein is called LovTAP: LOV- and tryptophan-activated protein. LOV domains bind a flavin-mononucleotide (FMN) or flavin-adenine-dinucleotide (FAD) cofactor, which are used in a wide variety of metabolic pathways as cofactors in redox reactions and are available in most organisms. The cofactor has a broad absorption spectrum, with a maximum at 450 nm. Besides, the core of the LOV domain is often flanked by amino- or carboxy-terminal helices, termed A???&#945; and J&#945;, respectively. In the LovTAP construction, AsLOV2 domain via its carboxyl-terminal J&#945; ???helix was ligated to an amino-terminal truncation of TrpR. The resulting protein has a domain-domain overlap with a shared helix. Thus, photoexcitation would change the conformation of the protein, in turn changing the stability of the shared-helix-domain contacts. Under the presence of light, absorption of a photon leads to the formation of a covalent adduct between the flavin mononucleotide (FMN) cofactor and a conserved cysteine residue in the AsLOV2 domain, which results in conformational rearrangements in LovTAP. This change impacts the affinity of the shared helix for the two domains: disrupting the contacts between the shared helix and the LOV domain and enabling the association of the shared helix with the TrpR domain, which establishes DNA-binding affinity and LovTAP can then bind DNA as an homodimer, repressing the transcription of the genes downstream of its binding sites. In the dark, when the shared helix contacts the LOV domain, the TrpR domain's DNA-binding affinity decreases and LovTAP is in an inactive conformation. false true _485_ 0 6618 9 In stock false We decided to synthesize a new LovTap part, that in comparison with the Part:BBa_K191006[1] that is already at the registry, has the following differences: 1. The 2 '''PstI restriction sites''' were '''removed''' from the coding region of LovTap. 2. We included a punctual mutation to change the '''ILE427 by a PHE427''', as was proposed by the model results of the team iGEM09_EPF-Lausanne [2]. With this mutation LovTAP should react faster and the conformational change should be more stable (the protein stays in the active form for longer, under light induction). The reason of the conformational change is the following: Cys450 side chain is involved in light state in bond formation with the cofactor. Cys450 can assume two conformational states, called here ON and OFF, and corresponding respectively, to the Sg being near or far from FMN[2]. The isoleucine 427 is quite big. But not enough to push the cystein's side chain significantly toward the cofactor. So we choose to replace this ILE427 by an PHE427, an amino acid which is much bigger and have more or less the same propreties than the ILE[2]. 5. The stop codon tga was changed for two taa. 1. Registry entry: Part:BBa_K191003 2. Wiki Team: EPF-Laussane. Simulations and results of predicted lovTAP mutations. 3. Wiki Team: EPF-Laussane. LovTAP characterization results. 4. Registry entry: Part:BBa_B0030 5. Registry entry: Part:BBa_B0032 6. Registry entry: Part:BBa_R0010 false Claudia Ivonne Hernandez Armenta, Jorge Zepeda annotation2091497 1 -10 range2091497 1 28 35 annotation2091493 1 trpR binding site -3.5 range2091493 1 29 45 annotation2091496 1 -35 range2091496 1 3 11 annotation2091495 1 trpR binding site -19.5 range2091495 1 13 30 annotation2091494 1 trpR binding site -11.5 range2091494 1 21 40 BBa_K093005_sequence 1 aaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_K360023_sequence 1 gctgttgacaattaatcatcgaactagttaactagtacgcaagttcacg BBa_B0034_sequence 1 aaagaggagaaa BBa_K360123_sequence 1 gctgttgacaattaatcatcgaactagttaactagtacgcaagttcacgtactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z