BBa_K360125 1 BBa_K360125 trpL promoter + cI inverter + GFP 2010-10-21T11:00:00Z 2015-05-08T01:12:12Z This composite part was obtained assembling existing Bioparts at the registry. The expression of the trp operon is repressed 300-fold by TrpR. TrpR binds at the trpLp promoter, possibly directly blocking binding by RNA polymerase Klig LS,1988. The blue light sensor LovTAP is a chiameric protein that contains the TrpR DNA-binding domain, so that is expected to regulate trpL promoter as the native TrpR transcriptional regulator. false false _485_ 0 6618 9 Not in stock false None false Claudia Ivonne Hernandez Armenta, Jorge Zepeda component2091801 1 BBa_K360024 component2091770 1 BBa_K360023 annotation2091770 1 BBa_K360023 range2091770 1 1 49 annotation2091801 1 BBa_K360024 range2091801 1 58 1928 BBa_C0051 1 cI lam cI repressor from E. coli phage lambda (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). Released HQ 2013 Coding region for the cI repressor based on cI repressor from bacteriophage lambda modified with an LVA tail for rapid degradation of the protein. cI repressor binds to the cI regulator (BBa_R0051).</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P> References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P>BBa_C0051 cI repressor is based on the cI repressor from the Elowitz's repressilator. It has been modified to include a rapid degradation LAA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA.<P> true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation2213991 1 Help:Barcodes range2213991 1 751 775 annotation23334 1 cI lambda range23334 1 4 711 annotation23335 1 LVA range23335 1 712 744 BBa_R0051 1 cI lam promoter (lambda cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false true _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation2022 1 -10 range2022 1 38 43 annotation2023 1 -35 range2023 1 15 20 annotation2025 1 OR2 range2025 1 1 17 annotation7067 1 BBa_R0051 range7067 1 1 49 annotation2024 1 OR1 range2024 1 25 41 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_P0451 1 BBa_P0451 PoPS -> cI (lambda) [S0153] 2004-04-26T11:00:00Z 2015-05-08T01:14:11Z Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false true Randy Rettberg component944973 1 BBa_B0010 component944957 1 BBa_B0034 component944967 1 BBa_C0051 component944983 1 BBa_B0012 annotation944967 1 BBa_C0051 range944967 1 19 768 annotation944957 1 BBa_B0034 range944957 1 1 12 annotation944983 1 BBa_B0012 range944983 1 890 930 annotation944973 1 BBa_B0010 range944973 1 802 881 BBa_K098991 1 BBa_K098991 cI promoter with GFP reporter 2008-10-25T11:00:00Z 2015-05-08T01:08:41Z Biobricks. Released HQ 2013 This is the a constitutive GFP reporter driven by the cI promoter. false false _196_ 0 3394 9 In stock true Obtained by cloning. true Harvard iGEM 08 component1989547 1 BBa_E0040 component1989539 1 BBa_R0051 component1989544 1 BBa_B0032 component1989548 1 BBa_B0010 component1989550 1 BBa_B0012 annotation1989539 1 BBa_R0051 range1989539 1 1 49 annotation1989547 1 BBa_E0040 range1989547 1 77 796 annotation1989550 1 BBa_B0012 range1989550 1 893 933 annotation1989548 1 BBa_B0010 range1989548 1 805 884 annotation1989544 1 BBa_B0032 range1989544 1 58 70 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K360023 1 BBa_K360023 trpL promoter 2010-10-20T11:00:00Z 2015-05-08T01:12:12Z LovTAP was assembled by Strickland et al. Reference Strickland, D., Moffat, K., & Sosnick, T. (2008). Light-activated DNA binding in a designed allosteric protein. Proceedings of the National Academy of Sciences, 105(31), 10709. National Acad Sciences. Retrieved from http://www.pnas.org/content/105/31/10709.full. Released HQ 2013 LovTAP This photoreceptor was assembled by Strickland et al., and consists of a LOV (light-oxygen-voltage) domain of Avena sativa phototropin1 (AsLOV2) that senses blue light, fused to the trpR- DNA binding domain of the transcription factor trp repressor. The resulting protein is called LovTAP: LOV- and tryptophan-activated protein. LOV domains bind a flavin-mononucleotide (FMN) or flavin-adenine-dinucleotide (FAD) cofactor, which are used in a wide variety of metabolic pathways as cofactors in redox reactions and are available in most organisms. The cofactor has a broad absorption spectrum, with a maximum at 450 nm. Besides, the core of the LOV domain is often flanked by amino- or carboxy-terminal helices, termed A???&#945; and J&#945;, respectively. In the LovTAP construction, AsLOV2 domain via its carboxyl-terminal J&#945; ???helix was ligated to an amino-terminal truncation of TrpR. The resulting protein has a domain-domain overlap with a shared helix. Thus, photoexcitation would change the conformation of the protein, in turn changing the stability of the shared-helix-domain contacts. Under the presence of light, absorption of a photon leads to the formation of a covalent adduct between the flavin mononucleotide (FMN) cofactor and a conserved cysteine residue in the AsLOV2 domain, which results in conformational rearrangements in LovTAP. This change impacts the affinity of the shared helix for the two domains: disrupting the contacts between the shared helix and the LOV domain and enabling the association of the shared helix with the TrpR domain, which establishes DNA-binding affinity and LovTAP can then bind DNA as an homodimer, repressing the transcription of the genes downstream of its binding sites. In the dark, when the shared helix contacts the LOV domain, the TrpR domain's DNA-binding affinity decreases and LovTAP is in an inactive conformation. false true _485_ 0 6618 9 In stock false We decided to synthesize a new LovTap part, that in comparison with the Part:BBa_K191006[1] that is already at the registry, has the following differences: 1. The 2 '''PstI restriction sites''' were '''removed''' from the coding region of LovTap. 2. We included a punctual mutation to change the '''ILE427 by a PHE427''', as was proposed by the model results of the team iGEM09_EPF-Lausanne [2]. With this mutation LovTAP should react faster and the conformational change should be more stable (the protein stays in the active form for longer, under light induction). The reason of the conformational change is the following: Cys450 side chain is involved in light state in bond formation with the cofactor. Cys450 can assume two conformational states, called here ON and OFF, and corresponding respectively, to the Sg being near or far from FMN[2]. The isoleucine 427 is quite big. But not enough to push the cystein's side chain significantly toward the cofactor. So we choose to replace this ILE427 by an PHE427, an amino acid which is much bigger and have more or less the same propreties than the ILE[2]. 5. The stop codon tga was changed for two taa. 1. Registry entry: Part:BBa_K191003 2. Wiki Team: EPF-Laussane. Simulations and results of predicted lovTAP mutations. 3. Wiki Team: EPF-Laussane. LovTAP characterization results. 4. Registry entry: Part:BBa_B0030 5. Registry entry: Part:BBa_B0032 6. Registry entry: Part:BBa_R0010 false Claudia Ivonne Hernandez Armenta, Jorge Zepeda annotation2091493 1 trpR binding site -3.5 range2091493 1 29 45 annotation2091497 1 -10 range2091497 1 28 35 annotation2091496 1 -35 range2091496 1 3 11 annotation2091495 1 trpR binding site -19.5 range2091495 1 13 30 annotation2091494 1 trpR binding site -11.5 range2091494 1 21 40 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K360024 1 BBa_K360024 RBS + cI inverter + GFP 2010-10-20T11:00:00Z 2015-05-08T01:12:12Z LovTAP was assembled in the following article: Strickland, D., Moffat, K., and Sosnick, T. (2008). Light-activated DNA binding in a designed allosteric protein. Proceedings of the National Academy of Sciences, 105(31), 10709. National Acad Sciences. Retrieved from http://www.pnas.org/content/105/31/10709.full. This photoreceptor was assembled by Strickland et al., and consists of a LOV (light-oxygen-voltage) domain of Avena sativa phototropin1 (AsLOV2)that senses blue light, fused to the trpR- DNA binding domain of the transcription factor trp repressor. The resulting protein is called LovTAP: LOV- and tryptophan-activated protein. LOV domains bind a flavin-mononucleotide (FMN) or flavin-adenine-dinucleotide (FAD) cofactor, which are used in a wide variety of metabolic pathways as cofactors in redox reactions and are available in most organisms. The cofactor has a broad absorption spectrum, with a maximum at 450 nm. Besides, the core of the LOV domain is often flanked by amino- or carboxy-terminal helices, termed Aa and Ja, respectively. In the LovTAP construction, AsLOV2 domain via its carboxyl-terminal Ja ???helix was ligated to an amino-terminal truncation of TrpR. The resulting protein has a domain-domain overlap with a shared helix. Thus, photoexcitation would change the conformation of the protein, in turn changing the stability of the shared-helix-domain contacts. Under the presence of light, absorption of a photon leads to the formation of a covalent adduct between the flavin mononucleotide (FMN) cofactor and a conserved cysteine residue in the AsLOV2 domain, which results in conformational rearrangements in LovTAP. This change impacts the affinity of the shared helix for the two domains: disrupting the contacts between the shared helix and the LOV domain and enabling the association of the shared helix with the TrpR domain, which establishes DNA-binding affinity and LovTAP can then bind DNA as an homodimer,repressing the transcription of the genes downstream of its binding sites. In the dark, when the shared helix contacts the LOV domain,the TrpR domain's DNA-binding affinity decreases and LovTAP is in an inactive conformation. false false _485_ 0 6618 9 It's complicated false We decided to synthesize a new LovTap part, that in comparison with the Part:BBa_K191006 [1] that is already at the registry, has the following differences: 1.The 2 PstI restriction sites were removed from the coding region of LovTap. 2.We included a punctual mutation to change the ILE427 by a PHE427, as was proposed by the model results of the team iGEM09_EPF-Lausanne [2]. With this mutation LovTAP should react faster and the conformational change should be more stable (the protein stays in the active form for longer, under light induction). The reason of the conformational change is the following: Cys450 side chain is involved in light state in bond formation with the cofactor. Cys450 can assume two conformational states, called here ON and OFF, and corresponding respectively, to the Sg being near or far from FMN[2]. The isoleucine 427 is quite big. But not enough to push the cystein's side chain significantly toward the cofactor. So we choose to replace this ILE427 by an PHE427, an amino acid which is much bigger and have more or less the same propreties than the ILE[2]. 3. The stop codon tga was changed for two taa. false Claudia Ivonne Hernandez Armenta component2091814 1 BBa_P0451 component2091831 1 BBa_K098991 annotation2091814 1 BBa_P0451 range2091814 1 1 930 annotation2091831 1 BBa_K098991 range2091831 1 939 1871 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_C0051_sequence 1 atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_K360023_sequence 1 gctgttgacaattaatcatcgaactagttaactagtacgcaagttcacg BBa_B0034_sequence 1 aaagaggagaaa BBa_K098991_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K360024_sequence 1 aaagaggagaaatactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtaacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0051_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc BBa_B0032_sequence 1 tcacacaggaaag BBa_P0451_sequence 1 aaagaggagaaatactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K360125_sequence 1 gctgttgacaattaatcatcgaactagttaactagtacgcaagttcacgtactagagaaagaggagaaatactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtaacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z