BBa_K360128 1 BBa_K360128 J23114 constitutive promoter + LovTAP Photosensor 2010-10-21T11:00:00Z 2015-05-08T01:12:12Z none none false false _485_ 0 6618 9 It's complicated false none false Claudia Ivonne Hernandez Armenta component2091975 1 BBa_J23114 component2091982 1 BBa_K360121 annotation2091982 1 BBa_K360121 range2091982 1 44 887 annotation2091975 1 BBa_J23114 range2091975 1 1 35 BBa_K360121 1 BBa_K360121 RBS + LovTAP Photosensor + terminator 2010-09-08T11:00:00Z 2015-05-08T01:12:12Z Chiameric protein assembled by Strickland et al. Reference: Strickland, D., Moffat, K., & Sosnick, T. (2008). Light-activated DNA binding in a designed allosteric protein. Proceedings of the National Academy of Sciences, 105(31), 10709. National Acad Sciences. Retrieved from http://www.pnas.org/content/105/31/10709.full. This photoreceptor was assembled by Strickland et al., and consists of a LOV (light-oxygen-voltage) domain of Avena sativa phototropin1 (AsLOV2) that senses blue light, fused to the trpR- DNA binding domain of the transcription factor trp repressor. The resulting protein is named LovTAP: LOV- and tryptophan-activated protein. LOV domains bind a flavin-mononucleotide (FMN) or flavin-adenine-dinucleotide (FAD) cofactor, which are used in a wide variety of metabolic pathways as cofactors in redox reactions and are available in most organisms. The cofactor has a broad absorption spectrum, with a maximum at 450 nm. Besides, the core of the LOV domain is often flanked by amino- or carboxy-terminal helices, termed A???α and Jα, respectively In the LovTAP construction, AsLOV2 domain via its carboxyl-terminal Jα ???helix was ligated to an amino-terminal truncation of TrpR. The resulting protein has a domain-domain overlap with a shared helix. Thus, photoexcitation would change the conformation of the protein, in turn changing the stability of the shared-helix-domain contacts. Under the presence of light, absorption of a photon leads to the formation of a covalent adduct between the flavin mononucleotide (FMN) cofactor and a conserved cysteine residue in the AsLOV2 domain, which results in conformational rearrangements in LovTAP. This change impacts the affinity of the shared helix for the two domains: disrupting the contacts between the shared helix and the LOV domain and enabling the association of the shared helix with the TrpR domain, which establishes DNA-binding affinity and LovTAP can then bind DNA as an homodimer, repressing the transcription of the genes downstream of its binding sites. In the dark, when the shared helix contacts the LOV domain, the TrpR domain's DNA-binding affinity decreases and LovTAP is in an inactive conformation. false false _485_ 0 6618 9 It's complicated true We decided to synthesize a new LovTAP part, that in comparison with the Part:BBa_K191003 that is already at the registry, has the following differences: 1. The 2 PstI restriction sites were removed from the coding region of LovTap. 2. We included a punctual mutation to change the ILE427 by a PHE427, as was proposed by the model results of the team iGEM09_EPF-Lausanne. With this mutation LovTAP should react faster and the conformational change should be more stable (the protein stays in the active form for longer, under light induction). 3. The part does not include a promoter. We eliminated the inverting regulator sensitive to LacI and CAP protein(Part:BBa_R0010). According to the report of EPF-Laussane team, the expression levels of LovTAP under the inverting regulator, doesn??t seem to show differences to the induction with IPTG. Thus, we decided to remove it and as we know that the level expression of LovTAP must be low (because at high levels of expresion, there is unspecific regulation under darkness and light states), we plan to test weak promoters to choose the best option and include it in the construction. 4. The RBS was changed from a strong (Part: BBa_B0030) to a medium strength (Part:BBa_B0032), thus expecting lower levels of lovTAP protein. 5. The stop codon tga was changed for two taa. false Claudia Ivonne Hernandez Armenta annotation2091649 1 Terminator B0010 range2091649 1 725 771 annotation2091648 1 LovTAP K360022 range2091648 1 18 701 annotation2091647 1 stop codon range2091647 1 702 706 annotation2091651 1 AAA range2091651 1 831 844 annotation2091650 1 Terminator B0012 range2091650 1 804 830 annotation2091646 1 RBS B0032 range2091646 1 1 13 BBa_J23114 1 BBa_J23114 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K360128_sequence 1 tttatggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaagtactatgttggctactacacttgaacgtattgagaagaactttgtcattactgacccaaggttgccagataatccctttatattcgcgtccgatagtttcttgcagttgacagaatatagccgtgaagaaattttgggaagaaattgtcgttttctacaaggtcctgaaactgatcgcgcgacagtgagaaaaattagagatgccatagataaccaaacagaggtcactgttcagctgattaattatacaaagagtggtaaaaagttctggaacctctttcacttgcagcctatgcgagatcagaagggagatgtccagtactttattggggttcagttggatggaactgagcatgtccgagatgctgccgagagagagggagtcatgctgattaagaaaaccgccgaaaatattgatgaggcggcatttgtcgacctgcttaagaatgcctaccaaaacgatctccatttaccgttgttaaacctgatgctgacgccagatgagcgcgaagcgttggggactcgcgtgcgtattgtcgaagagctgttgcgcggcgaaatgagccagcgtgagttaaaaaatgaactcggcgcgggcatcgcgacgattacgcgtggatctaacagcctgaaagccgcgcccgtggagctgcgccagtggctggaagaggtgttgctgaaaagcgattaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23114_sequence 1 tttatggctagctcagtcctaggtacaatgctagc BBa_K360121_sequence 1 tcacacaggaaagtactatgttggctactacacttgaacgtattgagaagaactttgtcattactgacccaaggttgccagataatccctttatattcgcgtccgatagtttcttgcagttgacagaatatagccgtgaagaaattttgggaagaaattgtcgttttctacaaggtcctgaaactgatcgcgcgacagtgagaaaaattagagatgccatagataaccaaacagaggtcactgttcagctgattaattatacaaagagtggtaaaaagttctggaacctctttcacttgcagcctatgcgagatcagaagggagatgtccagtactttattggggttcagttggatggaactgagcatgtccgagatgctgccgagagagagggagtcatgctgattaagaaaaccgccgaaaatattgatgaggcggcatttgtcgacctgcttaagaatgcctaccaaaacgatctccatttaccgttgttaaacctgatgctgacgccagatgagcgcgaagcgttggggactcgcgtgcgtattgtcgaagagctgttgcgcggcgaaatgagccagcgtgagttaaaaaatgaactcggcgcgggcatcgcgacgattacgcgtggatctaacagcctgaaagccgcgcccgtggagctgcgccagtggctggaagaggtgttgctgaaaagcgattaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z