BBa_K363012 1 BBa_K363012 Cnb1, the calcium sensitive regulatory subunit for calcineurin from S. cerevisiae 2010-10-25T11:00:00Z 2015-05-08T01:12:13Z This gene is from the eleventh chromosome of the yeast ''S. cerevisiae''. This part codes for the regulatory subunit of the protein phosphatase calcineurin of ''Saccharomyces cerevisiae''. In response to calcium, calcineurin dephosphorylates (among others) the transcription factor Crz1. This gene is part of a signaling cascade that was characterized by Johns Hopkins 2010 [[Part:BBa_K363006|here]]. false false _472_ 0 6798 9 Not in stock false This gene has been codon optimized for S. cerevisiae and has had restriction enzymes removed such that it is compatible with all five standards. false Justin Porter annotation2110068 1 CNB1 range2110068 1 1 528 BBa_K363012_sequence 1 atgggtgctgctccttccaaaattgtggatggtcttttagaagatacaaattttgatagagatgaaattgaaaggttaaggaagagattcatgaaattagatagagatagctcagggtctattgataaaaatgaatttatgagcattcctggcgtttcgtcaaaccctcttgctggacgtataatggaggttttcgatgctgataatagtggggacgtggattttcaagagttcatcacaggattatccattttcagtgggcgtgggtccaaggacgaaaagttaagattcgccttcaaaatctacgacattgacaaggacggtttcatatccaatggtgagttgttcatcgtgttgaagattatggtaggttctaatctggacgatgaacagctgcaacagatagtagataggacgatagtggaaaacgatagcgacggcgacggacgtttaagtttcgaggagtttaagaatgctatcgaaaccacagaagtggccaagagtctgacattgcaatacgatgtgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z