BBa_K364001 1 BBa_K364001 Human VDR DBD 2010-06-29T11:00:00Z 2015-05-08T01:12:13Z Human VDR (of the nuclear hormone receptor superfamily) Human vitamin D receptor dna binding domain false false _486_ 0 6746 9 Not in stock false The reconstruction of the DBD to the LBD will be done with RFC 25. false Ophir Keret annotation2072068 1 Zinc Finger (cys2/his2) range2072068 1 147 222 annotation2072067 1 Zinc Finger (cys2/his2) range2072067 1 40 102 BBa_K364001_sequence 1 cccgaccccggcgacttcgaccgcaacgtgccccgcatctgcggcgtgtgcggcgaccgcgccaccggcttccacttcaacgccatgacctgcgagggctgcaagggcttcttccgccgcagcatgaagcgcaaggccctgttcacctgccccttcaacggcgactgccgcatcaccaaggacaaccgccgccactgccaggcctgccgcctgaagcgctgcgtggacatcggcatgatgaaggagttcatcctgacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z