BBa_K364129 1 BBa_K364129 Zinc Finger Protein GTA 2010-07-26T11:00:00Z 2015-05-08T01:12:14Z Completely artificial This part codes for a Cys2His2 zinc finger protein to be used in assembly of zinc finger polymers (to be continued). false false _486_ 0 6746 9 Not in stock false Special RFC needs to be constructed for this purpose false Ophir Keret BBa_K364165 1 BBa_K364165 Zinc Finger Protein fixed N-terminus 2010-07-31T11:00:00Z 2015-05-08T01:12:14Z Completely artificial This protein domain should be used in construction of zinc finger polymers false false _486_ 0 6746 9 Not in stock false Requires a whole RFC false Ophir Keret BBa_K364200 1 BBa_K364200 PseudoGal4 2010-07-31T11:00:00Z 2015-05-08T01:12:14Z artifcial A zinc finger polymer designed to recognize a 12bp sequence in the Gal4 UAS consensus 17bp sequence false false _486_ 0 6746 9 Not in stock false zinc finger polymer standard false Ophir Keret component2076397 1 BBa_K364165 component2076401 1 BBa_K364167 component2076402 1 BBa_K364106 component2076399 1 BBa_K364167 component2076405 1 BBa_K364166 component2076400 1 BBa_K364109 component2076403 1 BBa_K364167 component2076404 1 BBa_K364138 component2076398 1 BBa_K364129 annotation2076401 1 BBa_K364167 range2076401 1 175 189 annotation2076405 1 BBa_K364166 range2076405 1 343 360 annotation2076399 1 BBa_K364167 range2076399 1 91 105 annotation2076398 1 BBa_K364129 range2076398 1 22 90 annotation2076397 1 BBa_K364165 range2076397 1 1 21 annotation2076402 1 BBa_K364106 range2076402 1 190 258 annotation2076400 1 BBa_K364109 range2076400 1 106 174 annotation2076404 1 BBa_K364138 range2076404 1 274 342 annotation2076403 1 BBa_K364167 range2076403 1 259 273 BBa_K364138 1 BBa_K364138 Zinc Finger Protein CGG 2010-07-26T11:00:00Z 2015-05-08T01:12:14Z Completely artificial This part codes for a Cys2His2 zinc finger protein to be used in assembly of zinc finger polymers (to be continued). false false _486_ 0 6746 9 Not in stock false Special RFC needs to be constructed for this purpose false Ophir Keret BBa_K364166 1 BBa_K364166 Zinc Finger Protein fixed C-terminus 2010-07-31T11:00:00Z 2015-05-08T01:12:14Z completely artificial C terminus, should be used in construction of zinc finger polymers false false _486_ 0 6746 9 Not in stock false requires a whole standard false Ophir Keret BBa_K364167 1 BBa_K364167 Zn Finger Linker segment 2010-07-26T11:00:00Z 2015-05-08T01:12:14Z Completely artificial Zn Finger Linker segment false false _486_ 0 6746 9 Not in stock false Requires a special standard false Ophir Keret BBa_K364109 1 BBa_K364109 Zinc Finger Protein ACA 2010-07-26T11:00:00Z 2015-05-08T01:12:13Z Completely artificial This part codes for a Cys2His2 zinc finger protein to be used in assembly of zinc finger polymers (to be continued). false false _486_ 0 6746 9 Not in stock false Special RFC needs to be constructed for this purpose false Ophir Keret BBa_K364106 1 BBa_K364106 Zinc Finger Protein AGG 2010-07-26T11:00:00Z 2015-05-08T01:12:13Z Completely artificial This part codes for a Cys2His2 zinc finger protein to be used in assembly of zinc finger polymers (to be continued). false false _486_ 0 6746 9 Not in stock false Special RFC needs to be constructed for this purpose false Ophir Keret BBa_K364106_sequence 1 tacaagtgccccgagtgcggcaagagcttcagccgcagcgaccacctgaccaaccaccagcgcacccac BBa_K364129_sequence 1 tacaagtgccccgagtgcggcaagagcttcagccagagcagcagcctggtgcgccaccagcgcacccac BBa_K364200_sequence 1 ctggagcccggcgagaagccctacaagtgccccgagtgcggcaagagcttcagccagagcagcagcctggtgcgccaccagcgcacccacaccggcgagaagccctacaagtgccccgagtgcggcaagagcttcagcagccccgccgacctgacccgccaccagcgcacccacaccggcgagaagccctacaagtgccccgagtgcggcaagagcttcagccgcagcgaccacctgaccaaccaccagcgcacccacaccggcgagaagccctacaagtgccccgagtgcggcaagagcttcagccgcagcgacaagctgaccgagcaccagcgcacccacaccggcaagaagaccagc BBa_K364165_sequence 1 ctggagcccggcgagaagccc BBa_K364138_sequence 1 tacaagtgccccgagtgcggcaagagcttcagccgcagcgacaagctgaccgagcaccagcgcacccac BBa_K364166_sequence 1 accggcaagaagaccagc BBa_K364167_sequence 1 accggcgagaagccc BBa_K364109_sequence 1 tacaagtgccccgagtgcggcaagagcttcagcagccccgccgacctgacccgccaccagcgcacccac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z