BBa_K364202 1 BBa_K364202 hBAX 2010-08-09T11:00:00Z 2015-05-08T01:12:14Z Human BAX (of the Bcl-2 gene family) Coding sequence of Bax (Bcl-2-associated X) protein which is a pro-apoptotic meber of the Bcl-2 protein family. It contains four BH (Bcl-2 homology) domains, can form homo- and heterodimers and plays essential role in the formation of MOMP (Mitochondrial outer membrane permeabilization) leading to apoptosis which is the most frequent type of PCD (Programmed cell death). false false _486_ 0 6885 9 It's complicated true Compatible with RFC-10 and RFC-25. false Endre K??roly Krist??f annotation2077559 1 BH2 domain range2077559 1 450 495 annotation2077560 1 Transmembrane domain range2077560 1 516 573 annotation2077558 1 BH1 domain range2077558 1 294 354 annotation2077557 1 BH3 domain range2077557 1 177 219 BBa_K364202_sequence 1 gacggcagcggcgagcagccccgcggcggcggccccaccagcagcgagcagatcatgaagaccggcgccctgctgctccagggcttcatccaggaccgcgcaggccgcatgggcggcgaggcccccgagctggccctggaccccgtgccccaggacgccagcaccaagaagctgagcgagtgcctgaagcgcatcggcgacgagctggacagcaacatggagctccagcgcatgatcgccgccgtggacaccgacagcccccgcgaggtgttcttccgcgtggccgccgacatgttcagcgacggcaacttcaactggggccgcgtggtggccctgttctacttcgccagcaagctggtgctgaaggccctgtgcaccaaggtgcccgagctgatccgcaccatcatgggctggaccctggacttcctgcgcgagcgcctgctgggctggatccaggaccagggcggctgggacggcctgctgagctacttcggcacccccacctggcagaccgtgaccatcttcgtggcaggcgtgctgaccgccagcctgaccatctggaagaagatgggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z