BBa_K364305 1 BBa_K364305 HUMAN CAR DBD 2010-08-17T11:00:00Z 2015-05-08T01:12:14Z nuclear hormone receptor superfamily The constitutive androstane receptor (CAR) also known as nuclear receptor subfamily 1, group I, member 3 is a protein that in humans is encoded by the NR1I3 gene.[1] CAR is a member of the nuclear receptor superfamily and along with PXR functions as a sensor of endobiotic and xenobiotic substances and in response upregulates the expression of proteins responsible for the metabolism and excretion of these substances.[2] Hence CAR (and PXR) are important in the detoxification of foreign substances such as drugs. false false _486_ 0 6826 9 Not in stock false This part will be fused with DBD and Backbone(PSB1C3) via 3-way assembly in accord with RFC25. false Liu Shun-Chieh annotation2078325 1 Zinc finger(Cys2/His2) range2078325 1 10 72 annotation2078324 1 Zinc finger(Cys2/His2) range2078324 1 118 192 BBa_K364305_sequence 1 ctgcgcaactgcgtggtgtgcggcgaccaggccaccggctaccacttcaacgccctgacctgcgagggctgcaagggcttcttccgccgcaccgtgagcaagagcatcggccccacctgccccttcgcaggaagctgcgaggtgagcaagacccagcgccgccactgccccgcctgccgcctccagaagtgcctggacgcaggcatgcgcaaggacatgatcctgagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z