BBa_K364307 1 BBa_K364307 Human ER DBD 2010-09-27T11:00:00Z 2015-05-08T01:12:14Z Human ER(of the nuclear hormone receptor superfamily) Estrogen receptor refers to a group of receptors that are activated by the hormone 17β-estradiol[1] (estrogen) , which is a member of the nuclear hormone family of intracellular receptors. The main function of the estrogen receptor is as a DNA-binding transcription factor that regulates gene expression. false false _486_ 0 6778 9 It's complicated true The reconstruction of the DBD to the hinge region, LBD and Backbone will be done with RFC 25 false Lior Malka annotation2093923 1 Zinc Finger (cys2/his2) range2093923 1 43 100 annotation2096966 1 Zinc Finger (cys2/his2) range2096966 1 148 220 BBa_K364307_sequence 1 aagggcagcatggccatggaaagcgccaaagagacacggtactgcgccgtgtgcaacgactacgccagcggctaccactacggcgtgtggtcctgcgagggctgcaaggccttcttcaagcggagcatccagggccacaacgactacatgtgccccgccaccaaccagtgcaccatcgacaagaaccggcggaagtcctgccaggcctgtcggctgcggaagtgctacgaagtgggcatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z