BBa_K364312 1 BBa_K364312 Human VDR hinge region 2010-09-29T11:00:00Z 2015-05-08T01:12:14Z Human VDR (of the nuclear hormone receptor superfamily) the vitamin D receptor (VDR) and also known as NR1I1 (nuclear receptor subfamily 1, group I, member 1), is a member of the nuclear receptor family of transcription factors. Upon activation by vitamin D, the VDR forms a heterodimer with the retinoid-X receptor and binds to hormone response elements on DNA resulting in expression or transrepression of specific geneproducts. In humans, the vitamin D receptor is encoded by the VDR gene. Hinge region: Thought to be a flexible domain that connects the DBD with the LBD. Influences intracellular trafficking and subcellular distribution. false false _486_ 0 6778 9 It's complicated true The reconstruction of the DBD to the hinge region and LBD will be done with RFC 25. false Lior Malka BBa_K364312_sequence 1 gatgaagaagtgcagcggaagcgcgagatgatcctgaagcggaaagaggaagaggccctgaaggacagcctgcggcccaagctgagcgaggaacagcagcggatcattgccatcctgctggacgcccaccacaagacctacgaccccacctacagcgatttctgccagttcagaccccccgtgcgcgtgaacgatggcggcggaagccacccctctcggcccaatagcagacacacccccagcttcagcggcgacagcagctctagctgtagcgaccactgtatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z