BBa_K364315 1 BBa_K364315 NHR-23 LBD 2010-09-30T11:00:00Z 2015-05-08T01:12:14Z C. elegans orphan nuclear receptor Nuclear hormone receptor family member nhr-23. The nhr-23 gene encodes a nuclear hormone receptor homolog that is required in all larval molts; NHR-23 is highly similar to Drosophila DHR3, an ecdysone-inducible gene product involved in metamorphosis. The NHR-23 protein is nuclear, and is present in all blastomeres during early embryogenesis; during later stages of morphogenesis, NHR-23 is restricted to epidermal cells. nhr-23 expression cycles between stages of larval development; during each intermolt period, levels of nhr-23 transcripts are 2-5 times greater than levels at each molt. NHR-23 binds the DRS-type hormone response sequence in vitro false false _486_ 0 6778 9 It's complicated true The reconstruction of the DBD to the hinge region, LBD and Backbone will be done with RFC 25 false Lior Malka BBa_K364315_sequence 1 cgcgagctgaaccccctgatccaggccatcatcgagttcgccaagagcatcgacggcttcatgaacctgccccaggagacccagatccaactgctgaagggcagcgtgttcgagctgagcctggtgttcgccgccatgtactacaacgtggacgcccaggccgtgtgcggcgagcgctacagcgtgcccttcgcctgcctgatcgccgaggacgacgccgagatgcaactgatcgtggaggtgaacaacaccctccaggagatcgtgcacctccagccccaccagagcgagctggccctgctggccgcaggcctgatcctggagcaggtgagcagcagccacggcatcggcatcctggacaccgccaccatcgccaccgccgagaccctgaagaacgccctgtaccagagcgtgatgccccgcatcggctgcatggaggacaccatccaccgcatccaggacgtggagacccgcatccgccagaccgcctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z