BBa_K364316 1 BBa_K364316 NHR-25 LBD 2010-09-30T11:00:00Z 2015-05-08T01:12:14Z C. elegans orphan nuclear receptor Nuclear hormone receptor family member nhr-25. nhr-25 encodes a nuclear hormone receptor orthologous to Drosophila Ftz-F1; NHR-25 is required for embryogenesis, molting, vulval and gonadal development, and hypodermal expression of acn-1; nhr-25 is expressed in gonads and loaded into embryos as a maternal transcript; nhr-25 is zygotically expressed in progeny of the E cell, and then in hypodermis and gut; the role of NHR-25 in molting may be evolutionarily conserved between nematodes and arthopods. false false _486_ 0 6778 9 It's complicated true The reconstruction of the DBD to the hinge region, LBD and Backbone will be done with RFC 25 false Lior Malka BBa_K364316_sequence 1 caggtggccgaggagaacctgaaggacatcgtgatctgggccaagaacgaccaactgttcagcaagctgagcctggacgaccagatgatcctgctccagacaagctggaccaccgtgcacatcgtggacatcaccaacgccatggtgcacggcaacctgctgagccagtacaagatgagcaacggcgacgaggtgcccgtgggcctggtggccctgctgggcaaccagaccttcgtgagtagctggaacgacgtggtgatccgcctgcgcaacatgggcttcaccaacttcgactactgcgccttccgcttcctggccctgttcgaccagagcatggacagcttccccgccgtgagcaccgcccgcagccgcgtgctccagagctggcgcgaggtgcgctgcaccaccgccttcctggagatcttcgagcagatccgccgcctggcctacgacagcctgcgctacctgtggaacctgcacagcaactgccccaccaactgggagcagttcttccccgaggccagcctggtgctggagatgatccgcaccaccgtgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z