BBa_K364330 1 BBa_K364330 TRE-PolyA 2010-10-19T11:00:00Z 2015-05-08T01:12:15Z Arteficial Tetracycline Response Element - minimal CMV promoter - PolyA tail false true _486_ 0 6885 9 It's complicated true Compatible with RFC-10 and RFC-25. false Endre K??roly Krist??f component2090733 1 BBa_K364304 component2090734 1 BBa_K364302 annotation2090733 1 BBa_K364304 range2090733 1 1 321 annotation2090734 1 BBa_K364302 range2090734 1 330 520 BBa_K364302 1 BBa_K364302 PolyA 2010-08-10T11:00:00Z 2015-05-08T01:12:14Z Arteficial The PolyA tail of mRNA has multiple adenilates which is important for the nuclear export, translation and stability of mRNA in eukaryotes. false false _486_ 0 6885 9 It's complicated true Compatible with RFC-10 and RFC-25. false Endre K??roly Krist??f BBa_K364304 1 BBa_K364304 TRE-CMV 2010-08-12T11:00:00Z 2015-05-08T01:12:14Z Arteficial The Tetracycline Response Element (TRE) is recognized and bound by the Tetracycline repressor (TetR) protein. The TRE consists of 7 repeats separated by spacer sequences and placed upstream of CMV minimal promoter that has basal expession in the abscence of bound TetR. Tetracycline derivatives (e.g. doxycycline) bind TetR and render it incapable of binding to TRE, thereby forcing the expression of target genes. false false _486_ 0 6885 9 It's complicated true Compatible with RFC-25 and RFC-10. false Endre K??roly Krist??f annotation2077769 1 7th tetO range2077769 1 223 241 annotation2077764 1 2nd tetO range2077764 1 45 63 annotation2077761 1 TRE range2077761 1 1 249 annotation2077763 1 1st tetO range2077763 1 9 27 annotation2077762 1 minimal P-CMV range2077762 1 255 315 annotation2077766 1 4th tetO range2077766 1 116 134 annotation2077767 1 5th tetO range2077767 1 152 170 annotation2077765 1 3rd tetO range2077765 1 80 98 annotation2077768 1 6th tetO range2077768 1 187 205 BBa_K364304_sequence 1 tcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttatccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcctgga BBa_K364302_sequence 1 ggatcataatcagccataccacatttgtagaggttttacttgctttaaaaaacctcccacacctccccctgaacctgaaacataaaatgaatgcaattgttgttgttaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcct BBa_K364330_sequence 1 tcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttatccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcctggatactagagggatcataatcagccataccacatttgtagaggttttacttgctttaaaaaacctcccacacctccccctgaacctgaaacataaaatgaatgcaattgttgttgttaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z