BBa_K365005 1 linker 20 aa linker RFC-25 (fusion standard Freiburg) 2010-09-13T11:00:00Z 2015-05-08T01:12:15Z DNA synthesis. 20 amino acids linker initially designed to link different ClpX subunits, according to the work of T.Baker et al. false false _477_ 0 6082 9 It's complicated false None. false STIEFEL Fabian & KALCHSCHMIDT Jens Sebastian BBa_K365005_sequence 1 gcgagcggcgcgggcggcagcgaaggcggcggcagcgaaggcggcaccagcggcgcgacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z