BBa_K367007 1 PfecA PfecA promoter region 2010-06-29T11:00:00Z 2015-05-08T01:12:15Z Ralstonia solanacearum GMI1000 plasmid pGMI1000MP, complete sequence NCBI Reference Sequence: NC_003296.1 The PprhJ promoter region, responsive to plant cell contact via signal transduction by PrhA and PrhR and activation by ECF sigma factor PrhI false false _492_ 0 6157 9 It's complicated true The boundaries of this promoter are unknown. The part contains sequencing spanning from the stop codon of the previous gene (prhR) to the start codon of prhJ. false Fernando Govantes annotation2072059 1 PfecA promoter region range2072059 1 1 86 BBa_K367007_sequence 1 tggataaacatttcaccactgtaaggaaaataattcttatttcgattgtcctttttacccttctcgttcgactcatagctgaacac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z