BBa_K367009 1 PfecA PfecA promoter region 2010-06-29T11:00:00Z 2015-05-08T01:12:15Z Escherichia coli str. K-12 substr. MG1655, complete genome GenBank: U00096.2 This part is identical to BBa_J07019 Escherichia coli PfecA promoter region, repressed by Fur under iron excess, and induced by ferric citrate through the FecA-FecR signal transduction pathway and the FecI ECF sigma factor false false _492_ 0 6157 9 It's complicated false The sequence is unedited from BBa_J07019. However, we may want to remove the Fur box if such thing is possible to prevent the requirement for low Fe for activation false Fernando Govantes annotation2072060 1 PfecA promoter region range2072060 1 1 86 BBa_K367009_sequence 1 tggataaacatttcaccactgtaaggaaaataattcttatttcgattgtcctttttacccttctcgttcgactcatagctgaacac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z