BBa_K371000 1 BBa_K371000 pduJK(Propanediol utilization gene J+K)[RBS+pduJ+RBS+pduK] 2010-08-26T11:00:00Z 2015-05-08T01:12:15Z pduAb come from Citrobacter Freundii genenom(NBRC NO.12681) Pdu, a abbreviation of propanediol utilization, is name of operon which is used for degradation propanediol to generate energy. Pdu operon consist of 21 genes. Some of these genes encode a series proteins which assemble to a large icosahedral protein complex. PduAB consist of pdu A and pdu B wich their natural RBS, which got from Citrobacter Freundii by PCR. PduAB, together with others struture part of pdu operon, can be used to construct a empty proteinous microcompartment in bacteria. false false _498_ 0 3984 9 It's complicated true The sequence results of pduAB, which we got by PCR from Citrobacter Freundii(NBRC NO.12681), are different from the sequence we found on the papar. We suspect that the strain we used is not same with the papar. false Yang Zhang annotation2078676 1 start codon range2078676 1 319 321 annotation2078673 1 pduK coding sequence range2078673 1 319 783 annotation2078675 1 pduK RBS range2078675 1 307 312 annotation2078672 1 pduJ coding sequence range2078672 1 19 294 annotation2078671 1 start codon range2078671 1 19 21 annotation2078670 1 pduJ RBS range2078670 1 5 12 annotation2078677 1 stop codon range2078677 1 781 783 annotation2078674 1 stop codon range2078674 1 292 294 BBa_K371000_sequence 1 ccacaggagaaaagcagtatgaataacgcactgggactggttgaaacaaaagggcttgtcggcgctattgaagccgctgatgccatggtgaaatccgcaaacgtgcagttggttggttacgaaaaaatcggctctggcctgatcaacgttatggttcgcggtgatgtcggcgcggtgaaagcagccgtagatgctggaagcgcagcagcaagcgccgttggtgaggtgaaatcctgccacgttatcccgcgtccgcacagcgacgttgaagccattttacctaaatccgcataagtcgttgcaaccaaggagcacagcgtgaagcaatcactgggattacttgaagttagtggtctggcattagccatcagttgcgcggacgtcatggcgaaagccgcctccatcacgctggtgggcctcgaaaaaaccaacggctcaggctggacggtgatcaagataatcggggatgtggcctccgtccaggcggccatttccactggtgtcagtttcgctgaccagcgagatggactggtggctcacaaagtcatttccagacccggggacgggatcctgtcgcatagcgttgtcctggagcctgaaccaacgcccgaccccataccagccataccacatgaagaaatccctgaggaccatgcggcacccgaagcaccgcaagatgcagaattgattagctgcaatttgtgtcttgatcctgcctgccctcgccaaaaaggtgagccgcgcacactttgtcttcactccggcaaacgaggtgaagcgtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z