BBa_K371004 1 BBa_K371004 pduN(Propanediol utilization gene N)[RBS+pduN] 2010-08-26T11:00:00Z 2015-05-08T01:12:15Z pduJK come from Citrobacter Freundii genenom(NBRC NO.12681) Pdu, a abbreviation of propanediol utilization, is name of operon which is used for degradation propanediol to generate energy. Pdu operon consist of 21 genes, which belongs to a kind of BMC(bacterial microcompartment).Some of these genes encode a series proteins which assemble to a large icosahedral protein complex. PduN consist of pdu N wich their natural RBS, which got from Citrobacter Freundii by PCR. PduN, together with others struture part of pdu operon, can be used to construct a empty proteinous microcompartment in bacteria. false false _498_ 0 3984 9 It's complicated true There are some silent mutation in sequencing result of pduN. false Yang Zhang annotation2078723 1 start codon range2078723 1 19 21 annotation2078724 1 RBS range2078724 1 4 12 annotation2078725 1 pduN conding sequence range2078725 1 19 294 annotation2078722 1 stop codon range2078722 1 292 294 BBa_K371004_sequence 1 attaagcaggagtgagctatgcatctggcacgggttacaggcgttgtggtttccacgcaaaaatctccatcactggtgggaaaaaaactgttgctggtacgtcgggtaagtgctgacggagagcttcctgcgtctccagtgagtggagatgaagtcgctgttgattctgtcggcgcggggaccggcgaactggtattactcagcagcgggtccagcgccagacacgttttttccggcccgaatgaggccattgatctggctatcgtcggcattgtcgacacgctttctcgttag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z