BBa_K371008 1 BBa_K371008 pduA 2010-10-07T11:00:00Z 2015-05-08T01:12:16Z Citrobactor freudii, the strain was bought from NITE Biological Resource Center (NBRC). NBRC NO. is 12681. History:IFO 12681 <- Ajinomoto Co., Inc. (AJ 2619) <- ATCC 8090 <- C.H. Werkman This part encodes pdu A, which is a shell protein of Citrobactor freundii. false false _498_ 0 3984 9 It's complicated true In order to isolate pduA from the Citrobactor freundii genome, following primers has been designed to make it a standard Biobrick. false Yang Zhang annotation2247243 1 pdu A range2247243 1 1 295 BBa_K371008_sequence 1 atgcaacaagaagcgttaggaatggtagaaaccaaaggcttgacagcagccatagaggccgcagatgcaatggtgaagtcagccaatgtaatgctggtcggctacgaaaaaattggttcggggctggtaacagttattgtccgcggcgatgtcggcgcagtcaaagcagcaacagatgccggtgccgccgcagcccgtaatgtgggagaagtgaaagccgtacacgttatcccacgcccgcataccgatgtagaaaaaatcttaccgaagggaattagcggttgaagagatctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z