BBa_K371014 1 BBa_K371014 pduP1-64 2010-10-08T11:00:00Z 2015-05-08T01:12:16Z Citrobactor freudii, the strain was bought from NITE Biological Resource Center (NBRC). NBRC NO. is 12681. History:IFO 12681 <- Ajinomoto Co., Inc. (AJ 2619) <- ATCC 8090 <- C.H. Werkm This part encodes pdu T proterin, which is a shell protein of Citrobactor freundii bacterial microcompartment(BMC) . false false _498_ 0 3984 9 It's complicated true In order to isolate pduA from the Citrobactor freundii genome, following primers has been designed to make it a standard Biobrick. false Yang Zhang annotation2372412 1 pduP1-64 range2372412 1 1 198 BBa_K371014_sequence 1 atgaacacttcagaacttgaaacccttattcgtaacattttgagtgagcaacttgccccggcaaaagcagaagttaagggtaatggaatttttccgtccgttagcgaagcgatcgatgccgctcatcaggcttttctgcgttatcagcaatgtccattgaaaacccgcagcgccatcattaacgccctgcgaggttga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z