BBa_K371024 1 BBa_K371024 10*GS linker(for RFC 53 protein fusion) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z This part is not long, so it can be easily get by direct annealing two oligonucleotides. This part is a short amino sequence used to link or fuse two protein domain together to make a large chimera protein. false false _498_ 0 3984 9 It's complicated true different codons of Gly and Ser was choosed in order to ignore the mismatch between forward sequence and reverse sequence when they are annealing. false Yang Zhang annotation2109630 1 10*GS range2109630 1 1 30 BBa_K371024_sequence 1 ggtagcggcagcggtagcggtagcggcagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z