BBa_K371024 1 BBa_K371024 10*GS linker(for RFC 53 protein fusion) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z This part is not long, so it can be easily get by direct annealing two oligonucleotides. This part is a short amino sequence used to link or fuse two protein domain together to make a large chimera protein. false false _498_ 0 3984 9 It's complicated true different codons of Gly and Ser was choosed in order to ignore the mismatch between forward sequence and reverse sequence when they are annealing. false Yang Zhang annotation2109630 1 10*GS range2109630 1 1 30 BBa_K371050 1 BBa_K371050 MSF(meta-suffix) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z direct synthesis This part is a extention of BioBrick prefix. It is used in noval BioBrick assemble standard BBF RFC 53. false false _498_ 0 3984 9 Not in stock true BBF RFC53 false Yang Zhang annotation2105197 1 EarI range2105197 1 2 7 annotation2105198 1 MSF range2105198 1 1 10 annotation2105196 1 BglII range2105196 1 6 10 annotation2110071 1 stop codon range2110071 1 1 3 BBa_K371021 1 BBa_K371021 GFP[intermediate] 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z the origin sequence of this part comes from BioBrick BBa_E1010 this part is a intermediate part, to see the detail design consideration please go to BBa_K371021 false false _498_ 0 3984 9 Not in stock false this part is a intermediate part used to generate part BBa_K371021 false Yang Zhang annotation2109384 1 GFP range2109384 1 1 717 annotation2109385 1 start codon range2109385 1 1 3 BBa_K371049 1 BBa_K371049 MPF(meta-prefix) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z direct synthesis This part is a extention of BioBrick prefix. It is used in noval BioBrick assemble standard BBF RFC 53. false false _498_ 0 3984 9 Not in stock true BBF RFC53 false Yang Zhang annotation2105194 1 SacI range2105194 1 1 6 annotation2105195 1 EarI range2105195 1 4 9 annotation2105192 1 SapI range2105192 1 3 9 annotation2105193 1 meta-prefix range2105193 1 1 10 BBa_K371014 1 BBa_K371014 pduP1-64 2010-10-08T11:00:00Z 2015-05-08T01:12:16Z Citrobactor freudii, the strain was bought from NITE Biological Resource Center (NBRC). NBRC NO. is 12681. History:IFO 12681 <- Ajinomoto Co., Inc. (AJ 2619) <- ATCC 8090 <- C.H. Werkm This part encodes pdu T proterin, which is a shell protein of Citrobactor freundii bacterial microcompartment(BMC) . false false _498_ 0 3984 9 It's complicated true In order to isolate pduA from the Citrobactor freundii genome, following primers has been designed to make it a standard Biobrick. false Yang Zhang annotation2372412 1 pduP1-64 range2372412 1 1 198 BBa_K371030 1 BBa_K371030 MPF(meta-prefix)+[pduP64+10*GS+GFP] fusion protein+MSF(meta-suffix) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z Citrobactor freudii, the strain was bought from NITE Biological Resource Center (NBRC). NBRC NO. is 12681. History:IFO 12681 <- Ajinomoto Co., Inc. (AJ 2619) <- ATCC 8090 <- C.H. Werkm This parts is a fusion protein between the N terminus 64 amino acid of pdu P protein and GFP protein(BBa_E0043). At each end is special DNA sequence that make this parts compatible to BBF RFC 53. The MPF and MSF is the abbreviation of meta-prefix and meta-suffix seperately. Because the N terminus is said to target pduP inside the pdu BMC, this part can be used to direct pduP-GFP chimera into BMC lumun. false false _498_ 0 3984 9 It's complicated true BBF RFC 10 RFC 53 false Yang Zhang component2373336 1 BBa_K371021 component2373333 1 BBa_K371024 component2373331 1 BBa_K371014 component2373329 1 BBa_K371049 component2373341 1 BBa_K371050 annotation2373333 1 BBa_K371024 range2373333 1 209 238 annotation2373331 1 BBa_K371014 range2373331 1 11 208 annotation2373329 1 BBa_K371049 range2373329 1 1 10 annotation2373336 1 BBa_K371021 range2373336 1 239 955 annotation2373341 1 BBa_K371050 range2373341 1 956 965 BBa_K371014_sequence 1 atgaacacttcagaacttgaaacccttattcgtaacattttgagtgagcaacttgccccggcaaaagcagaagttaagggtaatggaatttttccgtccgttagcgaagcgatcgatgccgctcatcaggcttttctgcgttatcagcaatgtccattgaaaacccgcagcgccatcattaacgccctgcgaggttga BBa_K371021_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactaccctgacctatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaaggt BBa_K371050_sequence 1 tgaagagatc BBa_K371030_sequence 1 gagctcttcaatgaacacttcagaacttgaaacccttattcgtaacattttgagtgagcaacttgccccggcaaaagcagaagttaagggtaatggaatttttccgtccgttagcgaagcgatcgatgccgctcatcaggcttttctgcgttatcagcaatgtccattgaaaacccgcagcgccatcattaacgccctgcgaggttgaggtagcggcagcggtagcggtagcggcagcatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactaccctgacctatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaaggttgaagagatc BBa_K371024_sequence 1 ggtagcggcagcggtagcggtagcggcagc BBa_K371049_sequence 1 gagctcttca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z