BBa_K371049 1 BBa_K371049 MPF(meta-prefix) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z direct synthesis This part is a extention of BioBrick prefix. It is used in noval BioBrick assemble standard BBF RFC 53. false false _498_ 0 3984 9 Not in stock true BBF RFC53 false Yang Zhang annotation2105194 1 SacI range2105194 1 1 6 annotation2105193 1 meta-prefix range2105193 1 1 10 annotation2105192 1 SapI range2105192 1 3 9 annotation2105195 1 EarI range2105195 1 4 9 BBa_K371017 1 BBa_K371017 pduV1-98 2010-10-08T11:00:00Z 2015-05-08T01:12:16Z Citrobactor freudii, the strain was bought from NITE Biological Resource Center (NBRC). NBRC NO. is 12681. History:IFO 12681 <- Ajinomoto Co., Inc. (AJ 2619) <- ATCC 8090 <- C.H. Werkman This part encodes the 1-98 amino acid of the N terminus pdu V proterin. The N terminus of Pdu V is thought to target to the outside of bacterial microcompartment. false false _498_ 0 3984 9 It's complicated true In order to isolate pduA from the Citrobactor freundii genome, following primers has been designed to make it a standard Biobrick. false Yang Zhang annotation2247440 1 pduV1-98 range2247440 1 1 188 BBa_K371031 1 BBa_K371031 MPF(meta-prefix)+[pduV98+10*GS+GFP] fusion protein+MSF(meta-suffix) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z Citrobactor freudii, the strain was bought from NITE Biological Resource Center (NBRC). NBRC NO. is 12681. History:IFO 12681 <- Ajinomoto Co., Inc. (AJ 2619) <- ATCC 8090 <- C.H. Werkm This parts is a fusion protein between the N terminus 98 amino acid of pdu V protein and RFP protein(BBa_E1010). At two side is special DNA sequence that make this parts compatible to BBF RFC 53. The MPF and MSF is the abbreviation of meta-prefix and meta-suffix seperately. Because the N terminus is said to target pduV outside the pdu BMC, this part can be used to direct pduV98-GFP chimera onto BMC surface. false false _498_ 0 3984 9 It's complicated true BBF RFC10 BBF RFC53 false Yang Zhang component2373312 1 BBa_K371049 component2373324 1 BBa_K371050 component2373319 1 BBa_K371021 component2373316 1 BBa_K371024 component2373314 1 BBa_K371017 annotation2373324 1 BBa_K371050 range2373324 1 946 955 annotation2373314 1 BBa_K371017 range2373314 1 11 198 annotation2373312 1 BBa_K371049 range2373312 1 1 10 annotation2373316 1 BBa_K371024 range2373316 1 199 228 annotation2373319 1 BBa_K371021 range2373319 1 229 945 BBa_K371024 1 BBa_K371024 10*GS linker(for RFC 53 protein fusion) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z This part is not long, so it can be easily get by direct annealing two oligonucleotides. This part is a short amino sequence used to link or fuse two protein domain together to make a large chimera protein. false false _498_ 0 3984 9 It's complicated true different codons of Gly and Ser was choosed in order to ignore the mismatch between forward sequence and reverse sequence when they are annealing. false Yang Zhang annotation2109630 1 10*GS range2109630 1 1 30 BBa_K371050 1 BBa_K371050 MSF(meta-suffix) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z direct synthesis This part is a extention of BioBrick prefix. It is used in noval BioBrick assemble standard BBF RFC 53. false false _498_ 0 3984 9 Not in stock true BBF RFC53 false Yang Zhang annotation2105198 1 MSF range2105198 1 1 10 annotation2110071 1 stop codon range2110071 1 1 3 annotation2105197 1 EarI range2105197 1 2 7 annotation2105196 1 BglII range2105196 1 6 10 BBa_K371021 1 BBa_K371021 GFP[intermediate] 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z the origin sequence of this part comes from BioBrick BBa_E1010 this part is a intermediate part, to see the detail design consideration please go to BBa_K371021 false false _498_ 0 3984 9 Not in stock false this part is a intermediate part used to generate part BBa_K371021 false Yang Zhang annotation2109384 1 GFP range2109384 1 1 717 annotation2109385 1 start codon range2109385 1 1 3 BBa_K371021_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactaccctgacctatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaaggt BBa_K371050_sequence 1 tgaagagatc BBa_K371017_sequence 1 atgaaacgcataatgctaattggccccagccagtgcggtaaaacgtcgctcacacagtgcatgcgcggagaggtgctccactatcagaagacccaggccatagtctggtcacctacgacaatagacacaccgggtgaatatcttgagaaccgctgcctgtacagtgcgctgctggccagcgcctgtga BBa_K371024_sequence 1 ggtagcggcagcggtagcggtagcggcagc BBa_K371049_sequence 1 gagctcttca BBa_K371031_sequence 1 gagctcttcaatgaaacgcataatgctaattggccccagccagtgcggtaaaacgtcgctcacacagtgcatgcgcggagaggtgctccactatcagaagacccaggccatagtctggtcacctacgacaatagacacaccgggtgaatatcttgagaaccgctgcctgtacagtgcgctgctggccagcgcctgtgaggtagcggcagcggtagcggtagcggcagcatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactaccctgacctatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaaggttgaagagatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z