BBa_K371049 1 BBa_K371049 MPF(meta-prefix) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z direct synthesis This part is a extention of BioBrick prefix. It is used in noval BioBrick assemble standard BBF RFC 53. false false _498_ 0 3984 9 Not in stock true BBF RFC53 false Yang Zhang annotation2105194 1 SacI range2105194 1 1 6 annotation2105193 1 meta-prefix range2105193 1 1 10 annotation2105192 1 SapI range2105192 1 3 9 annotation2105195 1 EarI range2105195 1 4 9 BBa_K371012 1 BBa_K371012 pduN 2010-10-08T11:00:00Z 2015-05-08T01:12:16Z Citrobactor freudii, the strain was bought from NITE Biological Resource Center (NBRC). NBRC NO. is 12681. History:IFO 12681 <- Ajinomoto Co., Inc. (AJ 2619) <- ATCC 8090 <- C.H. Werkm This part encodes pdu J proterin, which is a shell protein of Citrobactor freundii bacterial microcompartment(BMC) . false false _498_ 0 3984 9 It's complicated true In order to isolate pduA from the Citrobactor freundii genome, following primers has been designed to make it a standard Biobrick. false Yang Zhang annotation2247341 1 pdu N range2247341 1 1 289 BBa_K371050 1 BBa_K371050 MSF(meta-suffix) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z direct synthesis This part is a extention of BioBrick prefix. It is used in noval BioBrick assemble standard BBF RFC 53. false false _498_ 0 3984 9 Not in stock true BBF RFC53 false Yang Zhang annotation2105198 1 MSF range2105198 1 1 10 annotation2105197 1 EarI range2105197 1 2 7 annotation2110071 1 stop codon range2110071 1 1 3 annotation2105196 1 BglII range2105196 1 6 10 BBa_K371025 1 BBa_K371025 TAATAA[intermediate] 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z ~~~ This part consists of two stop codon taa. It is a intermidate part use to construct a complete fusion protein. For more disign consideration, please go to BBa_K371030 or BBa_K371031 false false _498_ 0 3984 9 Not in stock false ~~~ false Yang Zhang annotation2109483 1 stop codon range2109483 1 1 6 BBa_K371038 1 BBa_K371038 pduT 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z Citrobactor freudii, the strain was bought from NITE Biological Resource Center (NBRC). NBRC NO. is 12681. History:IFO 12681 <- Ajinomoto Co., Inc. (AJ 2619) <- ATCC 8090 <- C.H. Werkm pduN with MPF and MSF at each end. This part encodes pdu J proterin, which is a shell protein of Citrobactor freundii bacterial microcompartment(BMC) . false false _498_ 0 3984 9 Not in stock false .. false Yang Zhang annotation2112476 1 start codon range2112476 1 1 3 annotation2112477 1 pduT coding sequence range2112477 1 1 552 BBa_K371036 1 BBa_K371036 MPF(meta-prefix)+pduN+RBS+pduT+MSF(meta-suffix) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z Citrobactor freudii, the strain was bought from NITE Biological Resource Center (NBRC). NBRC NO. is 12681. History:IFO 12681 <- Ajinomoto Co., Inc. (AJ 2619) <- ATCC 8090 <- C.H. Werkman This part consist of pduN, pduT and RBS BBa_B0034. Pdu N and pdu T belong to shell protein of pdu BMC(baterial microcompartment). BMC is a large proteineious complex which are metabolically active struture that are bound by a proterinaceous shell. The shell of BMC consist of at least five different kind protein. These proterins share the same protein doman named BMC domain. false false _498_ 0 3984 9 It's complicated true this part is compatible with BBF RFC 53 standard false Yang Zhang component2372915 1 BBa_K371049 component2372921 1 BBa_B0034 component2372917 1 BBa_K371012 component2372929 1 BBa_K371050 component2372924 1 BBa_K371038 component2372919 1 BBa_K371025 annotation2372915 1 BBa_K371049 range2372915 1 1 10 annotation2372929 1 BBa_K371050 range2372929 1 870 879 annotation2372924 1 BBa_K371038 range2372924 1 318 869 annotation2372921 1 BBa_B0034 range2372921 1 306 317 annotation2372917 1 BBa_K371012 range2372917 1 11 299 annotation2372919 1 BBa_K371025 range2372919 1 300 305 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K371038_sequence 1 atgtctcaggctatagggattttagaactcaccagcattgccaaaggaatggaagctggcgatgccatgttaaaaagcgcgaatgtgaatttactggtcagcaagaccatctgcccgggaaaatttctactcatgctcggtggtgacgtaggtgccgtacaacaggcgattgccactggaacatctcttgctggcgatatgctcgttgatagtctggtactccccaacattcatgccagcgtactacccgcaatcagcggactaaacagcgtagataagcgtcaggcagttggtattgtcgaaacatggagcgttgctgcctgcatctgcgccgccgaccgggcggttaaagcctccaacgtcacgctggtccgcgtccatatggcatttggtattggcggcaagtgttacatggtcgtagctggcgatgtatccgatgtgaataacgcggtgacggttgccagtgaaagtgcgggtgaaaaaggcctgctggtttaccgctcggtcatcccccgtccacacgaaagcatgtggcgacagatggtggagggt BBa_K371036_sequence 1 gagctcttcaatgcatctggcacgggttacaggcgttgtggtttccacgcaaaaatctccatcactggtgggaaaaaaactgttgctggtacgtcgggtaagtgctgacggagagcttcctgcgtctccagtgagtggagatgaagtcgctgttgattctgtcggcgcggggaccggcgaactggtattactcagcagcgggtccagcgccagacacgttttttccggcccgaatgaggccattgatctggctatcgtcggcattgtcgacacgctttctcgtggttgaagagatctgataataaaaagaggagaaaatgtctcaggctatagggattttagaactcaccagcattgccaaaggaatggaagctggcgatgccatgttaaaaagcgcgaatgtgaatttactggtcagcaagaccatctgcccgggaaaatttctactcatgctcggtggtgacgtaggtgccgtacaacaggcgattgccactggaacatctcttgctggcgatatgctcgttgatagtctggtactccccaacattcatgccagcgtactacccgcaatcagcggactaaacagcgtagataagcgtcaggcagttggtattgtcgaaacatggagcgttgctgcctgcatctgcgccgccgaccgggcggttaaagcctccaacgtcacgctggtccgcgtccatatggcatttggtattggcggcaagtgttacatggtcgtagctggcgatgtatccgatgtgaataacgcggtgacggttgccagtgaaagtgcgggtgaaaaaggcctgctggtttaccgctcggtcatcccccgtccacacgaaagcatgtggcgacagatggtggagggttgaagagatc BBa_B0034_sequence 1 aaagaggagaaa BBa_K371050_sequence 1 tgaagagatc BBa_K371025_sequence 1 taataa BBa_K371049_sequence 1 gagctcttca BBa_K371012_sequence 1 atgcatctggcacgggttacaggcgttgtggtttccacgcaaaaatctccatcactggtgggaaaaaaactgttgctggtacgtcgggtaagtgctgacggagagcttcctgcgtctccagtgagtggagatgaagtcgctgttgattctgtcggcgcggggaccggcgaactggtattactcagcagcgggtccagcgccagacacgttttttccggcccgaatgaggccattgatctggctatcgtcggcattgtcgacacgctttctcgtggttgaagagatctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z