BBa_K371037 1 BBa_K371037 pduA 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z .. This parts is a fusion protein between pduA protein and RFP protein(BBa_E1010). At each end is special DNA sequence that make this parts compatible to BBF RFC 53. The MPF and MSF is the abbreviation of meta-prefix and meta-suffix seperately. Because pduA is said to be the shell protein of pdu BMC, this part can be used to direct pduA-RFP chimera into BMC lumun. false false _498_ 0 3984 9 It's complicated true .. false Yang Zhang annotation2112719 1 start codon range2112719 1 1 3 annotation2112720 1 pduA coding sequence range2112720 1 1 282 BBa_K371037_sequence 1 atgcaacaagaagcgttaggaatggtagaaaccaaaggcttgacagcagccatagaggccgcagatgcaatggtgaagtcagccaatgtaatgctggtcggctacgaaaaaattggttcggggctggtaacagttattgtccgcggcgatgtcggcgcagtcaaagcagcaacagatgccggtgccgccgcagcccgtaatgtgggagaagtgaaagccgtacacgttatcccacgcccgcataccgatgtagaaaaaatcttaccgaagggaattagcggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z