BBa_K371053 1 BBa_K371053 theRFC 10 and RFC53 interface converter 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z Since the sequence is not very long, you can easily get it by direct synthesis. This part locate in BBa_K371051, which is very like pSB1C3 with only a single site nonsense mutation between terminator 0 and chloramphenicol resistance gene. The function of this gene is to convert the any RFC53 part to RFC 10 part without leaving any trace. User will find it is very convenient to make fusion protein with this noval system. false false _498_ 0 7269 9 Not in stock true In the middle of this part is a NheI site, which is designed to examine the correctness of this system. false Ruijun Zhu annotation2113656 1 SapI range2113656 1 2 8 annotation2113653 1 EarI range2113653 1 24 29 annotation2113651 1 EarI range2113651 1 3 8 annotation2113655 1 SacI range2113655 1 1 6 annotation2113654 1 NheI range2113654 1 14 19 annotation2113652 1 BglII range2113652 1 28 32 BBa_K371053_sequence 1 gagctcttcaatggctagcggttgaagagatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z