BBa_K371057 1 BBa_K371057 ATG-MSF HeadPart 2010-11-05T12:00:00Z 2015-05-08T01:12:16Z synthesis ATG-MSF HeadPart false false _498_ 0 3908 9 Not in stock false ATG-MSF HeadPart false Hao Jiang component2113868 1 BBa_K371050 component2113863 1 BBa_K371056 annotation2113863 1 BBa_K371056 range2113863 1 1 3 annotation2113868 1 BBa_K371050 range2113868 1 4 13 BBa_K371050 1 BBa_K371050 MSF(meta-suffix) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z direct synthesis This part is a extention of BioBrick prefix. It is used in noval BioBrick assemble standard BBF RFC 53. false false _498_ 0 3984 9 Not in stock true BBF RFC53 false Yang Zhang annotation2105197 1 EarI range2105197 1 2 7 annotation2110071 1 stop codon range2110071 1 1 3 annotation2105198 1 MSF range2105198 1 1 10 annotation2105196 1 BglII range2105196 1 6 10 BBa_K371049 1 BBa_K371049 MPF(meta-prefix) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z direct synthesis This part is a extention of BioBrick prefix. It is used in noval BioBrick assemble standard BBF RFC 53. false false _498_ 0 3984 9 Not in stock true BBF RFC53 false Yang Zhang annotation2105193 1 meta-prefix range2105193 1 1 10 annotation2105192 1 SapI range2105192 1 3 9 annotation2105194 1 SacI range2105194 1 1 6 annotation2105195 1 EarI range2105195 1 4 9 BBa_K371060 1 BBa_K371060 GGT 2010-11-05T12:00:00Z 2015-05-08T01:12:16Z GGT GGT, codon for glycine. false false _498_ 0 3908 9 Not in stock false GGT false Hao Jiang BBa_K371058 1 BBa_K371058 B0034-ATG-MSF HeadPart 2010-11-05T12:00:00Z 2015-05-08T01:12:16Z synthesis B0034-ATG-MSF HeadPart false false _498_ 0 3908 9 Not in stock false B0034-ATG-MSF HeadPart false Hao Jiang component2113877 1 BBa_K371057 component2113870 1 BBa_B0034 annotation2113870 1 BBa_B0034 range2113870 1 1 12 annotation2113877 1 BBa_K371057 range2113877 1 19 31 BBa_K371025 1 BBa_K371025 TAATAA[intermediate] 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z ~~~ This part consists of two stop codon taa. It is a intermidate part use to construct a complete fusion protein. For more disign consideration, please go to BBa_K371030 or BBa_K371031 false false _498_ 0 3984 9 Not in stock false ~~~ false Yang Zhang annotation2109483 1 stop codon range2109483 1 1 6 BBa_K371059 1 BBa_K371059 MPF-GGTTAATAA TailPart 2010-11-05T12:00:00Z 2015-05-08T01:12:16Z synthesis MPF-TAATAA TailPart false false _498_ 0 3908 9 Not in stock false MPF-TAATAA TailPart false Hao Jiang component2113893 1 BBa_K371025 component2113891 1 BBa_K371060 component2113890 1 BBa_K371049 annotation2113893 1 BBa_K371025 range2113893 1 14 19 annotation2113891 1 BBa_K371060 range2113891 1 11 13 annotation2113890 1 BBa_K371049 range2113890 1 1 10 BBa_K371056 1 BBa_K371056 ATG 2010-11-05T12:00:00Z 2015-05-08T01:12:16Z ATG ATG false false _498_ 0 3908 9 Not in stock false ATG false Hao Jiang annotation2113878 1 start codon range2113878 1 1 3 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K371061 1 BBa_K371061 MPF-GGTTAATAA-B0034-ATG-MSF MetaPart 2010-11-05T12:00:00Z 2015-05-08T01:12:16Z synthesis MPF-GGTTAATAA-B0034-ATG-MSF MetaPart false false _498_ 0 3908 9 Not in stock false MPF-GGTTAATAA-B0034-ATG-MSF MetaPart false Hao Jiang component2113902 1 BBa_K371059 component2113912 1 BBa_K371058 annotation2113912 1 BBa_K371058 range2113912 1 28 58 annotation2113902 1 BBa_K371059 range2113902 1 1 19 BBa_B0034_sequence 1 aaagaggagaaa BBa_K371058_sequence 1 aaagaggagaaatactagatgtgaagagatc BBa_K371061_sequence 1 gagctcttcaggttaataatactagagaaagaggagaaatactagatgtgaagagatc BBa_K371050_sequence 1 tgaagagatc BBa_K371057_sequence 1 atgtgaagagatc BBa_K371059_sequence 1 gagctcttcaggttaataa BBa_K371025_sequence 1 taataa BBa_K371049_sequence 1 gagctcttca BBa_K371060_sequence 1 ggt BBa_K371056_sequence 1 atg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z